ID: 1155458021

View in Genome Browser
Species Human (GRCh38)
Location 18:26041918-26041940
Sequence CTGTCACTTCTCTCCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155458016_1155458021 13 Left 1155458016 18:26041882-26041904 CCAATCCCAAAGAGCTCAATTAC No data
Right 1155458021 18:26041918-26041940 CTGTCACTTCTCTCCCTCAGAGG No data
1155458017_1155458021 8 Left 1155458017 18:26041887-26041909 CCCAAAGAGCTCAATTACTACCC No data
Right 1155458021 18:26041918-26041940 CTGTCACTTCTCTCCCTCAGAGG No data
1155458018_1155458021 7 Left 1155458018 18:26041888-26041910 CCAAAGAGCTCAATTACTACCCT No data
Right 1155458021 18:26041918-26041940 CTGTCACTTCTCTCCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155458021 Original CRISPR CTGTCACTTCTCTCCCTCAG AGG Intronic