ID: 1155458401

View in Genome Browser
Species Human (GRCh38)
Location 18:26047131-26047153
Sequence TCTCACATCCTTGAGGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155458401_1155458404 30 Left 1155458401 18:26047131-26047153 CCTACTACCTCAAGGATGTGAGA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1155458404 18:26047184-26047206 GTTTTGTTTCTGTTAGCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 159
1155458401_1155458403 -2 Left 1155458401 18:26047131-26047153 CCTACTACCTCAAGGATGTGAGA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1155458403 18:26047152-26047174 GAATTAAAGAAGACATGCAAAGG 0: 1
1: 0
2: 0
3: 47
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155458401 Original CRISPR TCTCACATCCTTGAGGTAGT AGG (reversed) Intronic
902409402 1:16204316-16204338 TCTCAGATCATGGAGCTAGTAGG - Intronic
909119106 1:71578099-71578121 TCTCACACCCATCAGTTAGTAGG + Intronic
915228303 1:154427547-154427569 TCTGCCAGCCTTGAGGTAGAGGG + Intronic
915287487 1:154862254-154862276 TTTCTCATCCCTGAGATAGTTGG + Intronic
921966002 1:221090547-221090569 TTTCACATCCTTAAATTAGTGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1067777215 10:49172386-49172408 TCTCACAAGCTGGAGGAAGTGGG + Intronic
1071266563 10:83969794-83969816 TCTCTCATAGTTGAGGAAGTGGG - Intergenic
1071842847 10:89490787-89490809 TCTCTACTCCTGGAGGTAGTGGG + Intronic
1072934309 10:99697653-99697675 TGTCACATCCTTAAAATAGTCGG + Intronic
1077992755 11:7426489-7426511 TCTCACATCCTTCAGGCATTTGG + Intronic
1086546217 11:87970665-87970687 TCTGACATTCTCCAGGTAGTTGG + Intergenic
1092921678 12:13237227-13237249 TCTCACATACTTGATCTGGTTGG - Intergenic
1093861808 12:24175207-24175229 TCTAACATCTTTCATGTAGTGGG + Intergenic
1095524848 12:43113160-43113182 TTTCACATCCTTGAGGAATGTGG + Intergenic
1095650424 12:44601596-44601618 TTTGACATCCTTGAGTTAGCTGG - Intronic
1097936289 12:65255782-65255804 ACTCACATCTTTGAGGGAGAAGG - Intergenic
1100400636 12:94226182-94226204 TCTCACATCTTCCAGGCAGTTGG + Intronic
1104000386 12:124856536-124856558 TCTCACATGCTAGAAGGAGTAGG + Intronic
1104194799 12:126525359-126525381 TCTTACTGCCTAGAGGTAGTTGG + Intergenic
1104754777 12:131262177-131262199 TCTCACGTCCATGAGGAACTGGG + Intergenic
1107392609 13:39982833-39982855 TGTCACAGCTGTGAGGTAGTTGG + Intergenic
1115999386 14:39226723-39226745 TGTAACATCCTTGAAGTACTTGG + Intergenic
1119196616 14:72721853-72721875 TCTCACATTCTAGAAGTGGTGGG - Intronic
1125151990 15:36543066-36543088 TCACACATCCTTGAATTAATAGG + Intergenic
1128818300 15:70630069-70630091 TCTCCCATCCATCAGGTCGTGGG + Intergenic
1129607492 15:77031924-77031946 CCTCGCCTCCTTGAGGTAGAAGG + Intronic
1130109666 15:80954028-80954050 TCTAAGATCCTTGAGCCAGTGGG - Intronic
1130673781 15:85934959-85934981 TCCCAGATCCTGGCGGTAGTTGG - Intergenic
1140498634 16:75412571-75412593 TCCCACATCATTGAGGAAGCTGG + Exonic
1140853786 16:78959567-78959589 TCTCACAACCTAGAAGTAGATGG - Intronic
1141442532 16:84038792-84038814 TCACACATGCTTGATGGAGTGGG - Intronic
1142331085 16:89454382-89454404 TCTTACATCCTTGACCTAGTGGG + Intronic
1147926525 17:43949836-43949858 TCTGATATTCTTGGGGTAGTTGG - Intergenic
1149965492 17:61159556-61159578 TTTAACATCCTTGAGGAGGTGGG + Intronic
1150143410 17:62749058-62749080 TCTCAGATCCTGGAAGTAGGGGG - Intronic
1152136622 17:78507623-78507645 TGTCACCTCCTTCAGGAAGTGGG + Exonic
1155458401 18:26047131-26047153 TCTCACATCCTTGAGGTAGTAGG - Intronic
1155619965 18:27767407-27767429 CCTCACATCCTTGTGTTTGTAGG - Intergenic
1156346565 18:36262313-36262335 TCTCAGCTCCTTGAGGTGGGAGG + Intronic
1156775984 18:40789523-40789545 TCTCACATGCATTAGGCAGTTGG - Intergenic
1167851401 19:52205226-52205248 CCTCTCATCCCTGAGGCAGTGGG - Intronic
925199378 2:1953874-1953896 TCTCACTGCCATGAGGTAGGTGG - Intronic
925606378 2:5664985-5665007 TCTCACATCTGTGTGGTGGTAGG + Intergenic
926287940 2:11505489-11505511 CCTCACATCCCTGAGGATGTGGG - Intergenic
931228151 2:60351701-60351723 ACTCACATCCTTGAAGCAGGTGG + Intergenic
931877403 2:66528807-66528829 TCTCATATCCTACGGGTAGTAGG - Intronic
932475449 2:72003115-72003137 ACTCACCTCCTTGTGGTTGTGGG - Intergenic
939366880 2:141244951-141244973 TCAAACTTCCTTGATGTAGTAGG + Intronic
941883746 2:170507361-170507383 TCTCCCATACTTGAGAAAGTGGG + Intronic
945916681 2:215711637-215711659 GCTCACATTCTTGACCTAGTGGG + Intergenic
946912059 2:224473383-224473405 TCTGACATACTTGAATTAGTGGG + Exonic
948680012 2:239627238-239627260 ACCCACATCCTTGGGGGAGTCGG - Intergenic
1172270074 20:33650104-33650126 TCCCAAATCCTTGAGGAAGAGGG + Intergenic
1173104494 20:40120738-40120760 TCTCACATCCTTAAAGTACAGGG - Intergenic
1176241458 20:64077605-64077627 TTTCACAGCCTAGAGGCAGTGGG - Intronic
1182465677 22:30514727-30514749 TCTCCCTTCCTTGGGGAAGTAGG - Intergenic
1183498208 22:38162659-38162681 GCTCACATCTTTGAGGATGTGGG + Intronic
950326782 3:12117912-12117934 TCTAACACCCTCCAGGTAGTAGG - Intronic
952582846 3:34854889-34854911 TCTCAAATCCGTGAGTGAGTGGG - Intergenic
952678945 3:36068806-36068828 TCATACATCTTTGAGGTACTTGG - Intergenic
954935404 3:54322175-54322197 CCTCACCTCCTTGAGGCAGTGGG + Intronic
955403750 3:58612014-58612036 TGTCAGATCCTTAAGGTAGCTGG - Intronic
960989136 3:123299582-123299604 TCCCACGTCCTAGAGGTGGTAGG - Intronic
964420057 3:156492634-156492656 TCTCACAGCTTTGGGGTTGTTGG - Intronic
969535016 4:7751036-7751058 TGTCATATCATGGAGGTAGTGGG + Intergenic
969703271 4:8779303-8779325 TCTCCCATCCTTGAGGGCCTGGG - Intergenic
970806456 4:20041236-20041258 TCTGGAATCCTTGATGTAGTTGG + Intergenic
971147346 4:23993441-23993463 TCTCACTTCATGGAGGAAGTTGG - Intergenic
972788444 4:42348294-42348316 AGTCACATCCTTGAGGTATTAGG - Intergenic
973684441 4:53354953-53354975 TCTCAAATCCTTGAAGCAATTGG - Intronic
976146075 4:82043993-82044015 TCTCCCATGTTTGAGGTAGGTGG - Intronic
976608870 4:87008234-87008256 TCTCACATATTTAAAGTAGTAGG + Intronic
980282912 4:130743425-130743447 TCTCAAATACTTTAGGTAGTAGG + Intergenic
983094591 4:163546442-163546464 TATCACTTCCTTGTGGTACTAGG + Intronic
984719136 4:182953815-182953837 TCTCACACCCATCAGGAAGTAGG + Intergenic
991227308 5:64287833-64287855 TCTCCCATTCTTTAGGTTGTCGG + Intronic
991605713 5:68398596-68398618 TCTCAGGTTCTTGAGGTAGCTGG - Intergenic
993089361 5:83405254-83405276 TATCCCATACTTGAGGTTGTAGG + Intergenic
996042188 5:118827603-118827625 TCTCACATCCTTCAGATGTTGGG - Intergenic
996095548 5:119395158-119395180 TCTCACTTCCTAGAGCCAGTAGG + Intronic
999545018 5:152618267-152618289 TATCACATCCTTGAGGGCATGGG - Intergenic
1000213809 5:159136056-159136078 ACTCACAACCATGAGGTCGTGGG - Intergenic
1003012801 6:2441740-2441762 TTTCACAGCCATGATGTAGTGGG - Intergenic
1005758579 6:28947528-28947550 CCTCAGACCCTTGAGGTAGCTGG + Intergenic
1008799960 6:55354928-55354950 TCTCACCTCCCTGAGGGTGTCGG - Intronic
1014548977 6:122766478-122766500 TCCCACATCCTGGAGGCAGATGG + Intergenic
1023605682 7:41928859-41928881 TATCACATCCTGGAGCCAGTGGG - Intergenic
1028368240 7:90060182-90060204 GCTCGCAGCCTTGAGGTAGAGGG + Intergenic
1031851754 7:126873450-126873472 TCACACACCCTTAAGATAGTAGG + Intronic
1034350580 7:150412316-150412338 TCTTACCTCCTTGGGGCAGTGGG + Intronic
1035412620 7:158657508-158657530 AATCACATCCTTGAGGGAGGTGG + Intronic
1035950643 8:4016808-4016830 TTTGACATCCATGAGGTTGTTGG + Intronic
1039351544 8:36769176-36769198 ACTCACATCCTAGAGTTAATTGG + Intergenic
1042507911 8:69580714-69580736 CCTCACATCACTGAGGTAGAAGG + Intronic
1044846098 8:96383404-96383426 ATTCACTTCCTTGAGGTTGTAGG + Intergenic
1047199668 8:122754419-122754441 TCTCACATCCTTTAGGTGGATGG + Intergenic
1057986607 9:99722886-99722908 CCTCAAATCCTTGAGGCAGGGGG + Intergenic
1061106238 9:128532733-128532755 AGTCACTTCCTTGAGGTAGCTGG - Intronic
1061700255 9:132410257-132410279 TCTGGCATCCTTGAGGTCGCCGG - Exonic
1185913288 X:4006219-4006241 TCTCAGTTCCTTGTGGTTGTAGG + Intergenic
1187000062 X:15167545-15167567 TTTCACATCCTTGTGATTGTAGG + Intergenic
1187042797 X:15614653-15614675 TCACACATCCTTGTGCTATTGGG + Intergenic
1193491643 X:82157439-82157461 TCTCCCATTCTGGAGGTTGTCGG + Intergenic
1197644210 X:128999931-128999953 TCCTTCATCCTTCAGGTAGTTGG - Intergenic