ID: 1155460188

View in Genome Browser
Species Human (GRCh38)
Location 18:26071074-26071096
Sequence AAATGGTTGGAAAAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155460184_1155460188 30 Left 1155460184 18:26071021-26071043 CCAGTGAAAAATGAACTGGAAAA 0: 1
1: 0
2: 2
3: 44
4: 461
Right 1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG 0: 1
1: 0
2: 1
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155460188 Original CRISPR AAATGGTTGGAAAAGTCTGA AGG Intronic
901427072 1:9188986-9189008 AAATCTTCTGAAAAGTCTGATGG + Intergenic
902153001 1:14460233-14460255 AGTTGGTTAGAAAAGTCAGAGGG - Intergenic
902687153 1:18085713-18085735 CAATGAGGGGAAAAGTCTGATGG - Intergenic
902782843 1:18715956-18715978 AACAGGATGGAAAAGGCTGATGG - Intronic
902812485 1:18896480-18896502 TAATGGCTGGAAAAGTCAGGAGG - Intronic
904225793 1:29017921-29017943 GAAAGGTTGGAAAAGTCTAAAGG - Intronic
904398214 1:30237347-30237369 AGATGGATGGAAAACTGTGAAGG - Intergenic
905612855 1:39370097-39370119 AAATGGTTGAAAGAAACTGAAGG + Exonic
907074397 1:51565254-51565276 ATAAGGTTGGAAAGGTCTGTTGG - Intergenic
907932344 1:59012297-59012319 ATAAGGTTGAAAAAGTATGAAGG - Intergenic
908380357 1:63592508-63592530 ACATGGCTGGAAAAGTTTCACGG - Intronic
908878512 1:68704363-68704385 AAAGATTTGGGAAAGTCTGAGGG + Intergenic
909123329 1:71633531-71633553 AAATGACTGGAAAATCCTGAGGG + Intronic
909522679 1:76587795-76587817 ATGTGGGTGGAAAAGCCTGAAGG + Intronic
909692005 1:78419911-78419933 AAAAGGAAGGAAAAGGCTGATGG + Intronic
909902264 1:81152501-81152523 TAATGGTGGGAAGAATCTGAAGG - Intergenic
910468000 1:87520791-87520813 ACATGGTAAAAAAAGTCTGAAGG + Intergenic
910893366 1:92041379-92041401 TTATGGGTGAAAAAGTCTGAAGG - Intronic
913161586 1:116150504-116150526 GTATGGTTGGAACAGTGTGAAGG - Intergenic
913710095 1:121474093-121474115 AAAAGGTTGGAACAGTTTGGAGG - Intergenic
915554733 1:156655057-156655079 AGGTGGATGGTAAAGTCTGAAGG + Intronic
915993031 1:160536261-160536283 AAATGGTAGGAAAAGTTCCATGG - Intergenic
917334117 1:173910980-173911002 AAATGGTGGGAAAGGACAGAGGG - Intronic
919300161 1:195752085-195752107 AAATTGTTGGCAAAATCTGTTGG - Intergenic
920071270 1:203305060-203305082 GAATGGTTGGAAAATGCTGTGGG + Intergenic
922465206 1:225841895-225841917 AAATGGCTGGAACAGGCTGGGGG - Intronic
923302889 1:232659048-232659070 AAATGGCAGGAAAAGATTGAGGG - Intergenic
924158983 1:241210477-241210499 CAATGAATAGAAAAGTCTGATGG + Intronic
1063129284 10:3163697-3163719 ATTTTGTTGGAAAAGTTTGATGG - Intronic
1063684487 10:8223725-8223747 AAATGTTTGTGAAACTCTGATGG + Intergenic
1064084879 10:12337936-12337958 GAATGGTTGGGGAAGGCTGAGGG + Intergenic
1066635225 10:37493147-37493169 GAATGGTTGGGGAAGGCTGAGGG + Intergenic
1067057189 10:43059060-43059082 TAATGGATGGAAAAGGCAGAAGG - Intergenic
1068021030 10:51584456-51584478 AAATGATAGGAAAATTCTCAGGG + Intronic
1068995610 10:63199580-63199602 AAAATCTAGGAAAAGTCTGAAGG - Intronic
1069177010 10:65303443-65303465 AAATATTTGGAAAACTCTAATGG - Intergenic
1071858414 10:89648446-89648468 AAATGTTTGGAAGAGAGTGAGGG + Intergenic
1072704152 10:97668067-97668089 AAATGGTTTGAAAACTCTGTAGG + Intronic
1073732940 10:106312276-106312298 TAATGGTTGGAAAAGTTCAAAGG + Intergenic
1075571562 10:123550227-123550249 AGATGCTTGGAAAAGTCTTCTGG + Intergenic
1076225595 10:128772465-128772487 AAGAGGTTGGAACAGTTTGAAGG + Intergenic
1078665200 11:13318939-13318961 GAATGGTTGGAAAAGGTTGGGGG - Intronic
1078861025 11:15246587-15246609 TAATGGTTGGAAAAGTTTTTGGG - Exonic
1078943691 11:16038405-16038427 AAATGGATGGAAAAGTAGGAAGG + Intronic
1079492167 11:21001226-21001248 AAGTGGTTGGAAAGGTATGAGGG + Intronic
1079521071 11:21327653-21327675 AAGGGGTTGGAAAAGTTTGGAGG + Intronic
1079852345 11:25551627-25551649 AAAAGGATGGGAAAGTTTGAAGG - Intergenic
1081126182 11:39325475-39325497 AAATGGCAAGAAAAGTGTGATGG - Intergenic
1081536602 11:44001365-44001387 AAATGGCTAGAAAAGACTGATGG - Intergenic
1082588466 11:54973777-54973799 AGATGTTTGGAAGAGTATGAAGG + Intergenic
1083443677 11:62692938-62692960 GAATGGTTGGATGAGACTGAGGG - Intronic
1083719216 11:64595909-64595931 AGATGGTTGGAAAAGATGGATGG + Intronic
1085542187 11:77282045-77282067 ATGTGGTTGGAAAAGTATGTAGG + Intronic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1088600856 11:111473532-111473554 AAAAGGTTGGAAATGAGTGATGG + Intronic
1089122989 11:116153483-116153505 AAATGGTTGCCTAAGGCTGAGGG + Intergenic
1089801651 11:121035492-121035514 TAAAGGTTGCAAAAGTCTGCAGG - Intronic
1090232490 11:125118528-125118550 AAAGAGTAGGAAAAGACTGATGG + Intergenic
1092033661 12:5311404-5311426 AAAAGATTGGAAAATTCAGATGG - Intergenic
1092053211 12:5488166-5488188 AAATGCTTGGAAAGGGATGAAGG - Intronic
1092935198 12:13355449-13355471 AAATGTTCAGAAAAGTATGAAGG - Intergenic
1093094056 12:14952573-14952595 AACTGGTTGGAAAAAAATGAAGG + Intronic
1094602458 12:31921725-31921747 AAATGGTTTCCAAATTCTGAAGG - Intergenic
1094782507 12:33807727-33807749 AAATGGTATGGAAAGTGTGATGG - Intergenic
1095131679 12:38549806-38549828 AAAGGGTTGGAAAAGTATGGAGG - Intergenic
1098862654 12:75727552-75727574 AAAGGGCTGGAAGAGTCTAAAGG - Intergenic
1100680894 12:96919387-96919409 TAATGCTTAGAAAAGCCTGAGGG - Intronic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1101467604 12:104963544-104963566 TTATGGTAGGGAAAGTCTGAGGG + Intergenic
1101480005 12:105087373-105087395 AAATTGTTGGATAAGTTTGTAGG + Intergenic
1105530148 13:21211757-21211779 AGATGGTTGGAACAGTCTGGAGG + Intergenic
1106844082 13:33718902-33718924 TAATGGTTGCTAAAGTCTGGGGG + Intergenic
1107376211 13:39807433-39807455 AAAAGGTTGGAAGAGGGTGAGGG + Intergenic
1107526115 13:41233350-41233372 ATATGGTTTTAAAAGTCTAATGG - Intronic
1108114319 13:47110670-47110692 AAATGGGAGGAAAAGTGTCAAGG - Intergenic
1108274921 13:48798162-48798184 AAATGCTTTCAAAATTCTGAAGG + Intergenic
1108312959 13:49213856-49213878 AAATGGTAGTAAAAGTATCAGGG - Intergenic
1108583650 13:51849075-51849097 AAATGCTGGGAAAAGTCAAAAGG - Intergenic
1109584009 13:64374333-64374355 AAGAGGTTGGAACAGTCTGGAGG - Intergenic
1109730113 13:66401636-66401658 AAGTGGTATAAAAAGTCTGAAGG - Intronic
1109767319 13:66919813-66919835 AAATAATTAGAAAAGTATGAGGG + Intronic
1110566329 13:76960724-76960746 CAGAGGTTGGAAAAGTCTGAAGG - Intergenic
1110893020 13:80713730-80713752 AAAAGGTTGGAATAGTTTGGGGG - Intergenic
1112688111 13:101855668-101855690 TCATGGTTTGAAAAGTCTGAGGG + Intronic
1113130566 13:107032018-107032040 AAAGGGTAGGAAAAATCTAATGG + Intergenic
1114928205 14:27431978-27432000 AAATGCTTGGAAAACTATGGGGG + Intergenic
1115584095 14:34792516-34792538 AAATCATAGGAAAAGTCTAAAGG + Intronic
1116178143 14:41499784-41499806 AAAATGTTAGAAAAATCTGAAGG - Intergenic
1116663512 14:47744339-47744361 AAATTGTTGCAACAGTCTCATGG + Intergenic
1117256674 14:53985206-53985228 AAAAAGTTGGAACAGTTTGAAGG + Intergenic
1118265422 14:64289897-64289919 GAATGCTTGGGAAAGTGTGATGG - Intronic
1120631811 14:86900810-86900832 AAATGGATTGAAAAGTGTGAGGG + Intergenic
1121404378 14:93710281-93710303 AAATGGGTGGAGAACTGTGATGG + Intergenic
1122445779 14:101767554-101767576 AAAAGGTGGGAAGAGACTGATGG - Intronic
1124055841 15:26240378-26240400 AAATGGTTGGAAAATTCTTCAGG - Intergenic
1124230477 15:27941379-27941401 AAAAGGTTGGATAATTTTGACGG - Intronic
1124576982 15:30918461-30918483 AAATAGAAGGAAATGTCTGAAGG + Intronic
1124644356 15:31426213-31426235 CAGTGGTTGGAACAGTTTGAAGG - Intronic
1126647906 15:50893603-50893625 AAGAGGTTGGAACAGTCTGGAGG + Intergenic
1126774667 15:52090078-52090100 AAATGCCTCGAAAATTCTGAAGG + Intergenic
1126942916 15:53785528-53785550 CAAAGGTTGGAAGAGTCCGAAGG - Intergenic
1126946360 15:53825404-53825426 TAATGGTTATAAAAGTCTTACGG - Intergenic
1127966763 15:63928484-63928506 AAAAGGTTGGGAAGGGCTGATGG + Intronic
1128270671 15:66306539-66306561 AAATGGCTGGAAGTCTCTGAAGG + Intronic
1129900563 15:79145051-79145073 AAGAGGTTGGAACAGTCTGGAGG - Intergenic
1130081496 15:80737857-80737879 AAAATGTTGGAATAGTCGGATGG + Intronic
1130762243 15:86832755-86832777 CAGAGGTTGGAACAGTCTGAAGG - Intronic
1130982682 15:88823560-88823582 GAATCGTGGGAAAAGGCTGATGG + Intronic
1131224822 15:90615792-90615814 AAATGCTGGGAAAAGTTTGAAGG - Intronic
1132321506 15:100928968-100928990 GAATGGTTGGAAAGCTTTGATGG + Intronic
1135262650 16:20994657-20994679 AAGTGGTTGTCAAAGTCTGGAGG - Intronic
1135740348 16:24969863-24969885 AAATGGACTGAAAAGTCTGAAGG + Intronic
1139726919 16:68907630-68907652 AAATGCTTTGAAAATTCTAAGGG - Intronic
1140654943 16:77130846-77130868 ATCTGGTTGGAAATGTCTGGAGG - Intergenic
1142402301 16:89866201-89866223 ATATGCTTGGAAAAGCCTGGAGG + Intronic
1142524313 17:528265-528287 TAATGGTTGGCAAAGGCTGAGGG - Intronic
1144533103 17:16059438-16059460 AAATGGTAGAGAATGTCTGAAGG + Intronic
1147792200 17:43021037-43021059 AACTGGTTGGCCAAGTCTGCAGG - Intronic
1148114690 17:45168870-45168892 AAATGGTTCCAAAAGGTTGAGGG + Intronic
1148171758 17:45526750-45526772 ACATGGTTTTAAATGTCTGAAGG - Intergenic
1149392062 17:56202068-56202090 AAAGGGTTGGAAAAGATTAAAGG - Intronic
1149983970 17:61333241-61333263 AAGTGGCTGGCAAGGTCTGAGGG - Intronic
1151036867 17:70810693-70810715 AACTGGTTTGAAAAGCTTGAGGG + Intergenic
1152106078 17:78329818-78329840 AAGTGGCTGGAAAACTCTGCAGG - Intergenic
1153756927 18:8293558-8293580 AGATGGGTGGAAAAGGCAGAGGG + Intronic
1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG + Intronic
1156370473 18:36467963-36467985 AAATGATTTGCACAGTCTGAAGG + Intronic
1157077160 18:44478695-44478717 CAAAGGTTGGAAAAGTTTGGAGG + Intergenic
1159136681 18:64345019-64345041 AATTTGTTGGAAAACTATGAGGG + Intergenic
1159780534 18:72655859-72655881 ACATGGCTGGGAAAGTCTCATGG - Intergenic
1160630560 18:80244350-80244372 AAATGTTTGGAGAAGTATAAGGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1167178940 19:47886878-47886900 AAATGATTCAAAAAGTCTCAGGG - Intergenic
925205598 2:2003292-2003314 AAATTGTTGAAAAAGTCAGCAGG + Intronic
926816807 2:16805606-16805628 CAGTGGTTGGAACAGTCTGGAGG - Intergenic
928709516 2:33988445-33988467 AAAAGGTTGGAAGAGTTTGGAGG - Intergenic
928735460 2:34283400-34283422 AAATGGTTGGACAAATGTGTGGG + Intergenic
929009736 2:37429209-37429231 AAAGGGTGGGAAAAGGGTGAGGG - Intergenic
929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG + Intergenic
930853754 2:55989661-55989683 AGATGGTGGGGAAACTCTGAGGG - Intergenic
931250763 2:60528948-60528970 AGCTGGTTGGGAGAGTCTGAGGG - Intronic
931487609 2:62708602-62708624 AAATGCTTGGAACAGTGTCAGGG + Intronic
935415857 2:102818047-102818069 AATTGGCTGGATATGTCTGAAGG + Intronic
935433459 2:103002992-103003014 AAAAGGGTGGAAAAGTTTCAGGG - Intergenic
936560510 2:113535049-113535071 AAAAGATTGGTAAACTCTGATGG + Intergenic
936721551 2:115257176-115257198 AAAGGGTTGGAAGAGTTTGAAGG - Intronic
937147197 2:119657736-119657758 AAATGATGAGAAAAGACTGAGGG - Intronic
939289985 2:140181696-140181718 AAATGGTACTAAAAGACTGAGGG + Intergenic
940271515 2:151896338-151896360 GAATGGTTGGAAGTCTCTGAAGG + Intronic
940381438 2:153018954-153018976 AAAAGGGTGGAACAGTTTGAAGG - Intergenic
940652770 2:156454010-156454032 TAATGGGTGGTAAAGTCTAATGG + Intronic
941622077 2:167789722-167789744 AAAGGGATGGAAAACTCTGGAGG - Intergenic
941867709 2:170351788-170351810 AAATTCATGGAATAGTCTGAAGG + Intronic
943108008 2:183571359-183571381 CAAAGGTTGGAAAAGTTTGGAGG + Intergenic
943202488 2:184846684-184846706 TCATGTTTGGAAAAATCTGAAGG - Intronic
943272242 2:185821387-185821409 AGTTTTTTGGAAAAGTCTGAGGG - Intronic
943717484 2:191168128-191168150 AAATTGTTAGATTAGTCTGACGG - Intergenic
943926274 2:193784966-193784988 AAATGGATGGAAAAGTGGGTTGG + Intergenic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
946331477 2:219011607-219011629 AAGGGGGCGGAAAAGTCTGAGGG + Intronic
946544419 2:220722035-220722057 AAATGGTGGGAGAGGTATGAGGG - Intergenic
1169433913 20:5567294-5567316 AAATGGTTGGAGAAGACAGCTGG + Intronic
1169735906 20:8837361-8837383 AAAAGTTTGGAAAACTGTGAGGG + Intronic
1170077611 20:12436932-12436954 AAATGGTTGGTAAATTCTGATGG + Intergenic
1170452857 20:16503464-16503486 AAATGTTTTGAAAATACTGATGG - Intronic
1170765690 20:19288549-19288571 AAATGCTTTGAAATGTCTAAAGG - Intronic
1170938452 20:20829292-20829314 CAAAGGTTGGAACAGTTTGAGGG + Intergenic
1172328038 20:34052634-34052656 AACTGTTTGGAAACATCTGATGG - Intronic
1174037252 20:47675806-47675828 ACATGTTTGGGAAAGCCTGAAGG - Intronic
1177069102 21:16480067-16480089 AAATGGTAGGAGAAGGATGAAGG - Intergenic
1177506501 21:22026576-22026598 AAATGGTTGGAAGGGTCCGGTGG + Intergenic
1177949553 21:27517433-27517455 AAGAGGTTGGAACAGTTTGAAGG + Intergenic
1178512500 21:33217331-33217353 ACATGGTGGGAAAAGTTTGATGG + Intergenic
1182650744 22:31849173-31849195 CAAAGGTTGGAACAGTCTGGGGG - Intronic
1183124307 22:35760981-35761003 AAATAGTTGGAAAAGGTAGAGGG - Intronic
1183769449 22:39911461-39911483 AAAGGTTTCCAAAAGTCTGACGG - Intronic
1185134393 22:49061018-49061040 AAGTGGTCAGAAAAGTATGAAGG - Intergenic
949200263 3:1369220-1369242 AAATGTTTGGCAAATCCTGAGGG - Intronic
950700801 3:14744465-14744487 CAAAGGTTGGAACAGTTTGAAGG - Intronic
951350998 3:21606738-21606760 AATGGGGTGGAAAGGTCTGATGG - Intronic
952614267 3:35250537-35250559 ACATGGGTGGAATAGACTGATGG + Intergenic
953302718 3:41794905-41794927 AAATCCTAGGAAATGTCTGAAGG + Intronic
955013453 3:55044132-55044154 AAATATTTTGAAAAGTCTGCTGG + Intronic
955540720 3:59973266-59973288 ATATGGTAGGAAATGACTGAAGG - Intronic
956446377 3:69330213-69330235 AAATGGGTAGAAAATTCAGAAGG - Intronic
956541761 3:70348095-70348117 AAATGATTGGAACATACTGAAGG + Intergenic
956878493 3:73487781-73487803 AAATTGCTGGAAAGGTCAGATGG - Intronic
960665955 3:120108936-120108958 AAATTGTTTGAAAACTCTAAAGG + Intergenic
961396614 3:126597401-126597423 AAATGTTTGAAAAAATTTGACGG + Intronic
961944890 3:130675634-130675656 AAGTGTTTTGAAAAGTCTAATGG + Exonic
962195164 3:133355783-133355805 AACTGGTTAGATAAGTCTAAAGG + Intronic
962470548 3:135704023-135704045 AAATGGTTGAAAACCTGTGAGGG + Intergenic
962646519 3:137445881-137445903 CAAAGGTTGGAACAGTTTGAGGG - Intergenic
963149088 3:142025153-142025175 AATTGGTTGGGAGTGTCTGAAGG - Intronic
964303735 3:155318426-155318448 ACATGTTTGGACAACTCTGAGGG - Intergenic
965349297 3:167594189-167594211 CAAAAGTTGGAAAAGTTTGAAGG + Intronic
965732417 3:171786186-171786208 AAATAGTTGGAAAAGTTTATTGG - Intronic
967309913 3:188096091-188096113 AAAAGGGAGGAAAAGTCTGTGGG + Intergenic
967512651 3:190329931-190329953 AAACAGTTGAAAAAGTATGATGG + Intronic
969261977 4:6039393-6039415 ATAAAGTTGGAAAACTCTGAAGG - Intronic
970263592 4:14256085-14256107 AATGGGTTGGAAAGGTCTGGTGG + Intergenic
971607895 4:28682350-28682372 AAAAGGTTTTAAAATTCTGAGGG + Intergenic
971637472 4:29080264-29080286 GATTGTGTGGAAAAGTCTGAGGG + Intergenic
971931083 4:33084006-33084028 ACATAGATGGAATAGTCTGAAGG + Intergenic
972157075 4:36177171-36177193 AAATGTTTTGATGAGTCTGATGG - Intronic
973615200 4:52671092-52671114 AAATGGATTCAAAAGTCTCAAGG + Intergenic
974066979 4:57087657-57087679 CAATAGTTGGTAAAGTCAGAGGG + Intronic
974772568 4:66434790-66434812 CAGTGGTTGGAAAAGTTTGGAGG - Intergenic
976015310 4:80545451-80545473 AGATGTTTGTAATAGTCTGAGGG - Intronic
976032942 4:80779648-80779670 ACAGGGTTGGAAGAGGCTGAAGG - Intronic
976461834 4:85320764-85320786 AAATCCATAGAAAAGTCTGAGGG + Intergenic
976480088 4:85532527-85532549 AAATTGTTGAAAAAGAATGATGG - Intronic
977538880 4:98290628-98290650 AAAGGCTTGGCAAAGTTTGAAGG + Intronic
978823125 4:112988890-112988912 AAATGGTAAAAAAATTCTGATGG + Intronic
979733296 4:124051715-124051737 AAATGGTTTGAAAAGGATGTAGG + Intergenic
980876841 4:138670324-138670346 AAATGGCTGGAAAAGGCTGGGGG - Intergenic
980974053 4:139594063-139594085 AAATGGTTGGGATTGTTTGATGG - Intronic
981005638 4:139872371-139872393 AAATGGAAAGAAAAGCCTGACGG + Intronic
982023174 4:151224463-151224485 ATATTTTTGAAAAAGTCTGAAGG - Intronic
983498921 4:168477802-168477824 AAGTGATTGGAAAAGGTTGATGG + Intronic
983820550 4:172188586-172188608 AAATGCTTGAAATGGTCTGAAGG + Intronic
985896643 5:2752864-2752886 AAAGGGTTGGAGAAGCGTGATGG - Intronic
986021340 5:3806629-3806651 AAATGGTCAGAAAAGTTTGCTGG - Intergenic
986106080 5:4661014-4661036 AAATGTTTGGAAATGTATGTGGG - Intergenic
987424478 5:17756999-17757021 AAATGGTAGGAAAATCCTGTGGG + Intergenic
987464098 5:18251985-18252007 ACATGGTTGGAGAGGTCTCACGG - Intergenic
987662702 5:20897560-20897582 AAATGTATGGAAAATTCAGATGG - Intergenic
987689142 5:21244596-21244618 CAAAGGTTGGAAGAGTCTGGAGG + Intergenic
988186096 5:27864279-27864301 AAATGTTTGGAAAAAGTTGAGGG - Intergenic
988200026 5:28055470-28055492 CAAGGGTTGGAAAAGTTTGGAGG - Intergenic
988759989 5:34304638-34304660 AAATGTATGGAAAATTCAGATGG + Intergenic
989966772 5:50474363-50474385 AAAAGGTTGGAACAGTTTGGAGG + Intergenic
991105025 5:62833696-62833718 CAATGGTTGGAACAGTTTGGAGG - Intergenic
992903585 5:81323116-81323138 ATATGGCTGGAAAAGAATGAAGG + Intergenic
993007132 5:82440864-82440886 AAATGGTGAGAAAAGGCTAATGG - Intergenic
993343114 5:86749636-86749658 AAAAGGTTGGAAAATTCTACTGG + Intergenic
993810881 5:92474331-92474353 AAATGTATGGAAAAGCCTGTAGG + Intergenic
994965843 5:106669759-106669781 TAATGTTTTGAAAACTCTGAAGG - Intergenic
996155732 5:120097114-120097136 AAATGGTTTGTGAATTCTGATGG + Intergenic
997750319 5:136338094-136338116 AAATGCTTTGAAAATTCAGAAGG - Intronic
998553273 5:143097937-143097959 TATTGGTTGTAAAAGTCTGGAGG + Intronic
998680474 5:144461236-144461258 AAAAGCATGGAAAAGACTGATGG + Intronic
1001190954 5:169630756-169630778 AAATGGTGGGAAGAGGGTGAGGG - Intergenic
1001552640 5:172615255-172615277 AAATGGTTAGCAGAGGCTGAGGG + Intergenic
1001569355 5:172719929-172719951 ACAAGGTTGGAGAAGTCTGCGGG - Intergenic
1003401859 6:5797131-5797153 AAATGGTTGGAACAGTTTGGAGG - Intergenic
1003702749 6:8488015-8488037 AAATGTTTAGAAAAATCTTAAGG + Intergenic
1003804623 6:9713295-9713317 AAATGGATGAAAAATTCTGTGGG - Intronic
1005127874 6:22469829-22469851 AAATGGTTGGCAGAGGCTGTGGG + Intergenic
1005563267 6:27063044-27063066 AAATGGATGGAAAAACCTGGAGG - Intergenic
1005970708 6:30758951-30758973 AAATGCTTGGTATAGGCTGATGG + Intergenic
1007343968 6:41214206-41214228 AAACAGAGGGAAAAGTCTGAAGG - Intergenic
1008104768 6:47429556-47429578 CAGAGGTTGGAAAAGTCTGGAGG - Intergenic
1009334107 6:62463790-62463812 AAATAGTTCTAAAAGTATGAGGG + Intergenic
1009377646 6:62991647-62991669 AAGTGGTTGGAACAGTTTGGAGG - Intergenic
1009699655 6:67160156-67160178 AAGTGGTTGGAATAGTTTGGAGG + Intergenic
1009780393 6:68261263-68261285 AAGTGGTTGGGAAAGTTGGAGGG - Intergenic
1011971037 6:93223185-93223207 AAGGTGTTGGAAAAGACTGAAGG + Intergenic
1014661867 6:124181876-124181898 AAGAGGTTGGAACAGTTTGAAGG - Intronic
1015328802 6:131953349-131953371 TAATGGTTGGAAAGGTGTGGTGG + Intergenic
1015484259 6:133750265-133750287 AAGTGTTTGGAAAATTATGAAGG + Intergenic
1016067008 6:139694333-139694355 ACATGGTAGGAAAAGTCTGTTGG + Intergenic
1016624252 6:146147023-146147045 AAATTTTTGAAAAAGTCAGATGG - Intronic
1016754051 6:147664039-147664061 AAATGGTTAGAGAAATCTCAAGG + Intronic
1020521306 7:9190583-9190605 AAACTGTGGGAAAAGTGTGAGGG + Intergenic
1020546525 7:9540181-9540203 AAGAGGTTGGAACAATCTGAAGG + Intergenic
1021285060 7:18770774-18770796 ACATGGTTGTAAAAGTATAAAGG + Intronic
1021301441 7:18978162-18978184 AAATGGATGGAAAAGAGTGAAGG + Intronic
1021922781 7:25503481-25503503 AGCTGTTTGGAAAATTCTGAGGG + Intergenic
1022976748 7:35565610-35565632 AAGTGGTTGGCAAAGTTTTATGG + Intergenic
1023605273 7:41925520-41925542 AAAGGCTTGGTAAAGTGTGAGGG - Intergenic
1024369645 7:48566184-48566206 AAATGTTTGGAGCACTCTGAGGG - Intronic
1026159947 7:67859953-67859975 AAAAGGTAGGAAAAGGGTGAAGG - Intergenic
1026888343 7:73967556-73967578 AAATGGTTGGAGGAGGCTGCTGG + Intergenic
1027556122 7:79666813-79666835 AAATGTTATGCAAAGTCTGAGGG + Intergenic
1027813825 7:82943286-82943308 AAATTGTTGAACAAGTCTAAGGG + Intronic
1030806717 7:113928957-113928979 AACTGGTTGGAACAGTTTGGGGG + Intronic
1031022837 7:116647041-116647063 CAGTGGCTGGAAAAGTCCGAGGG - Intergenic
1031712866 7:125071083-125071105 AAAAGGCTAGAAAAGTCTTATGG + Intergenic
1032674115 7:134112801-134112823 AAAGGGAAGGAAAATTCTGAGGG - Intergenic
1032911798 7:136440849-136440871 AAATGGTGGGAGAAGGGTGAGGG - Intergenic
1033359284 7:140626661-140626683 AGAGGGTGGGAAGAGTCTGAGGG - Intronic
1036713233 8:11096587-11096609 AAATGCTTGGAAAAGGAAGATGG + Intronic
1037712477 8:21366093-21366115 AAATGGTTAGTAGAGTCTGGAGG - Intergenic
1039439843 8:37587459-37587481 AAAGGGTGGGAAAAGGGTGAGGG - Intergenic
1039877246 8:41597292-41597314 AAGTGTTTGGAATAGCCTGAAGG + Intronic
1041222853 8:55669409-55669431 CAGAGGTTGGAAAAGTTTGAAGG + Intergenic
1041984932 8:63910179-63910201 CAAAGGTTGGAACAGTCTGGAGG - Intergenic
1042702893 8:71636349-71636371 AAATGCTTGGAAAACTCAGCTGG - Intergenic
1045321602 8:101086016-101086038 AAGTCGTTGGAAAAATATGAGGG - Intergenic
1047095295 8:121618498-121618520 AAACAGCTGGAAAAGGCTGATGG + Intronic
1047794155 8:128236848-128236870 AAATGGAAGCAGAAGTCTGAAGG + Intergenic
1048136818 8:131754179-131754201 AAATGGTTGGTTAAGTTAGAAGG + Intergenic
1048454678 8:134567037-134567059 AAAGGTTTACAAAAGTCTGAAGG - Intronic
1048915743 8:139181370-139181392 AAGAGGTTGGAACAGTCTGGAGG + Intergenic
1049892170 9:80296-80318 AAAAGATTGGTAAACTCTGATGG - Intergenic
1050773079 9:9227805-9227827 AAAGGGTTGGAAAGGGCTGGAGG - Intronic
1051946973 9:22581092-22581114 AAATGGTGGGGAAAGGCTGAGGG + Intergenic
1052176081 9:25464364-25464386 GAGAGGTTGGAATAGTCTGAAGG - Intergenic
1052651744 9:31312073-31312095 ATATGCTAAGAAAAGTCTGAAGG - Intergenic
1053733592 9:41081384-41081406 AAAAGATTGGTAAACTCTGATGG - Intergenic
1054694823 9:68350175-68350197 AAAAGATTGGTAAACTCTGATGG + Intronic
1054706550 9:68468622-68468644 AAATTATTAGAAAATTCTGAAGG - Intronic
1055800830 9:80033699-80033721 AAAACGTTGGAAGAGTTTGAAGG - Intergenic
1055969517 9:81897977-81897999 GAAGGGTTGGAAAAGGGTGAGGG + Intergenic
1056136539 9:83634962-83634984 AAGTGATTGGAAAGTTCTGAGGG - Intronic
1056646907 9:88420733-88420755 AAAATGTTGGAAAAGACTAAAGG - Intronic
1056911988 9:90709449-90709471 GAATGCTTTCAAAAGTCTGAGGG + Intergenic
1057706330 9:97397692-97397714 AGATGGTTGAAAAAGGGTGACGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058613241 9:106797880-106797902 AAATGGTTGGAGAAGTGGGAAGG - Intergenic
1058626990 9:106944332-106944354 ATATTGTTTTAAAAGTCTGATGG - Intronic
1059815888 9:117914303-117914325 AATTGTTTGGAAAAGTTTGAGGG - Intergenic
1060538678 9:124414399-124414421 AAATTGTTGGAAACGTCAAAAGG - Intronic
1186242290 X:7582438-7582460 AAAGGATTTGCAAAGTCTGATGG + Intergenic
1186647930 X:11526953-11526975 TAATGGTTGGAAAACACTAAAGG + Intronic
1186732729 X:12427648-12427670 AAATAGTTTTAAAAGGCTGATGG + Intronic
1187599439 X:20811470-20811492 AAATGTTTTTAAAAATCTGATGG - Intergenic
1187772037 X:22710128-22710150 TAAAGGTTGAAAAAGTCTGTGGG - Intergenic
1189656723 X:43252188-43252210 AAGTGGTTGGAAGAGTTTGGAGG - Intergenic
1190454676 X:50616134-50616156 AAATGATTGGACAAGGCTGAAGG - Intronic
1191900452 X:66034817-66034839 TTATGGATGGAAAATTCTGATGG - Intronic
1192829699 X:74738705-74738727 AAAATTTTGGAAAAGTCTGAAGG - Exonic
1193186743 X:78522385-78522407 AAATGGATGGGGATGTCTGATGG + Intergenic
1193893180 X:87077479-87077501 AAATGGTTGGCATCTTCTGAGGG + Intergenic
1193950120 X:87787371-87787393 ACATGGTTGGGAAGGTCTCATGG + Intergenic
1194725637 X:97392961-97392983 AAATTGTTGGAAAGGTAGGATGG + Intronic
1195759885 X:108234977-108234999 CAATTGTTAGAAAAGTGTGAAGG + Intronic
1196218337 X:113081838-113081860 AAAGGGTGGGAAAAGGGTGAGGG - Intergenic
1196722086 X:118864000-118864022 AAATGTGAGGAAAAGTCTAAGGG - Intergenic
1196755888 X:119156641-119156663 AAATGGCTGGAAAATTCTAATGG + Intergenic
1197472585 X:126881777-126881799 CAGAGGTTGGAAAAGTCTGGAGG + Intergenic
1200366704 X:155673594-155673616 TAAAGCTTGGAACAGTCTGAAGG - Intergenic