ID: 1155460581

View in Genome Browser
Species Human (GRCh38)
Location 18:26077515-26077537
Sequence ACAAGGTACACGTAGTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155460581_1155460583 -10 Left 1155460581 18:26077515-26077537 CCAATGCACTACGTGTACCTTGT 0: 1
1: 0
2: 2
3: 1
4: 42
Right 1155460583 18:26077528-26077550 TGTACCTTGTTTGGATTCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155460581 Original CRISPR ACAAGGTACACGTAGTGCAT TGG (reversed) Intronic
923640690 1:235756924-235756946 ACAAGGAATACGTGGTTCATTGG - Intronic
1072071433 10:91921862-91921884 AGAGGGTATACGTAGTGCAAAGG - Intergenic
1075713486 10:124542994-124543016 ACAGGGCACACGCAGTGCAGGGG - Intronic
1078269299 11:9780201-9780223 GCAAGATACAGGGAGTGCATGGG + Exonic
1084557831 11:69885513-69885535 CCAGGGTGCACCTAGTGCATGGG - Intergenic
1090055916 11:123424821-123424843 ATAAGATACACATGGTGCATTGG - Intergenic
1096253975 12:50051663-50051685 AAAAGGTTCACATAGTGCCTGGG - Intergenic
1109150448 13:58841046-58841068 AGAAGGTACACCTAGTGCATAGG - Intergenic
1111024853 13:82507571-82507593 AAAAGGTAGAAGTAATGCATGGG - Intergenic
1132576981 16:668695-668717 ACAAGGTACCCGTGGTGCGCGGG + Exonic
1135201903 16:20444865-20444887 ATAAAGTACAAGTAGTGAATAGG + Intergenic
1135217201 16:20583001-20583023 ATAAAGTACAAGTAGTGAATAGG - Intergenic
1149532891 17:57409683-57409705 ACTTGGTACAAGTAGTGCGTGGG + Intronic
1155460581 18:26077515-26077537 ACAAGGTACACGTAGTGCATTGG - Intronic
1167826634 19:51979260-51979282 ACAGGGAAAACGTAGTGCACAGG - Intronic
928650143 2:33395398-33395420 ACAAGGTACACATAGGGAAATGG + Intronic
928835976 2:35545504-35545526 ACAAGGCAAACTAAGTGCATTGG + Intergenic
929763104 2:44822202-44822224 GGAAGGGACACGTACTGCATTGG - Intergenic
934084742 2:88500643-88500665 ACAAAGTACAAGTAATGCAAGGG - Intergenic
938441313 2:131336444-131336466 ACAAGGTAAACTTAGTGAAATGG - Intronic
941484955 2:166068376-166068398 ACAAGGAAGAAATAGTGCATAGG + Intronic
942571300 2:177317284-177317306 ACAAGTTACACGTAATGCATGGG - Intronic
946100061 2:217312848-217312870 AGAAGGTACAGGAAGTGCAAAGG + Intronic
947891401 2:233624487-233624509 CAAAGGTACAAGAAGTGCATTGG - Intronic
1169851766 20:10060133-10060155 ACAATGTACACGTATTACTTTGG + Intergenic
1170529888 20:17280708-17280730 ATGAGGTACACCTAGTGCCTGGG + Intronic
1170872458 20:20219118-20219140 ACAATGAACAAGTAGTGGATTGG - Intronic
1179785064 21:43724916-43724938 ACAGGGTCTACCTAGTGCATCGG - Intronic
959561718 3:107789948-107789970 ACAAGGCAAAGGCAGTGCATGGG - Intronic
963595821 3:147322958-147322980 AAATGGTACACTTTGTGCATTGG + Intergenic
967622168 3:191647418-191647440 ACAAGGTAAATGTAGTGCCAGGG - Intergenic
972939098 4:44175648-44175670 ACAAAGGACACCTAGTGCAGTGG - Intronic
974795864 4:66748426-66748448 ACAAGATACCAGTAGTTCATTGG + Intergenic
983953420 4:173669422-173669444 ACAAGCAACACGAAGTACATAGG + Intergenic
988223241 5:28376663-28376685 AAAAGGAACAGGAAGTGCATAGG + Intergenic
1001307857 5:170588792-170588814 AAAAGGGACATGTAGTGCAGGGG + Intronic
1003548084 6:7077916-7077938 ACAAGGTACACGTTGTTCCTTGG - Intergenic
1005828190 6:29649090-29649112 ACAAGGTACATAAAGTGCTTAGG - Intergenic
1007952316 6:45883425-45883447 ACAAGGTGGAAGTAGAGCATGGG + Intergenic
1012411240 6:98959844-98959866 AAAAGGGACACGTATTGCCTTGG + Intergenic
1013162715 6:107561251-107561273 GCAAGGCATACGTAGTTCATGGG + Intronic
1013484913 6:110587658-110587680 ACAAGGAACAAAAAGTGCATTGG - Intergenic
1032850905 7:135794243-135794265 TCAAGATACAAGTAGTACATTGG - Intergenic
1036169949 8:6473932-6473954 ACAAGGAAGAAGTTGTGCATCGG - Intronic
1044390491 8:91644825-91644847 ACAAGGTATTCATAATGCATGGG + Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic