ID: 1155461725

View in Genome Browser
Species Human (GRCh38)
Location 18:26090908-26090930
Sequence CGCCGCCGCGGGAGAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155461717_1155461725 7 Left 1155461717 18:26090878-26090900 CCTCCGCTTCAGCGATTCAGGAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157
1155461718_1155461725 4 Left 1155461718 18:26090881-26090903 CCGCTTCAGCGATTCAGGAAATG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157
1155461714_1155461725 11 Left 1155461714 18:26090874-26090896 CCTCCCTCCGCTTCAGCGATTCA 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157
1155461716_1155461725 8 Left 1155461716 18:26090877-26090899 CCCTCCGCTTCAGCGATTCAGGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157
1155461713_1155461725 17 Left 1155461713 18:26090868-26090890 CCTAGTCCTCCCTCCGCTTCAGC 0: 1
1: 0
2: 6
3: 33
4: 388
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157
1155461712_1155461725 18 Left 1155461712 18:26090867-26090889 CCCTAGTCCTCCCTCCGCTTCAG 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155461725 Original CRISPR CGCCGCCGCGGGAGAAGGAG AGG Intronic
900382499 1:2391818-2391840 CGGCGCCGCGGAGGACGGAGCGG + Exonic
901060913 1:6471539-6471561 CGCCGGTGCTGGAGAAGGCGCGG - Exonic
902823394 1:18956739-18956761 CGCCGCAGAGGGAGGAGGGGTGG - Intergenic
903455428 1:23483999-23484021 CGCTGGCGCGGGAGGAGGTGAGG - Exonic
903555128 1:24187419-24187441 CCCCGCCGCGGGGGGAGGGGGGG + Intronic
903652332 1:24929796-24929818 CGCCGCCGCAGGGGAAGGCCGGG + Exonic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904619039 1:31764411-31764433 AGGAGCCGCGGGAGAAGGGGCGG + Intronic
904619073 1:31764520-31764542 CGCCGGCGCGGGAGAAGCCCTGG + Intronic
905018785 1:34794524-34794546 AGCGGCTGCGGCAGAAGGAGGGG + Exonic
906179317 1:43804805-43804827 GGCAGGCGAGGGAGAAGGAGAGG + Intronic
907880609 1:58546476-58546498 CGCCGGGGCGGGAGACGGAGGGG - Intronic
914993090 1:152515445-152515467 CGCCGGGGCGGGACACGGAGCGG - Exonic
915916873 1:159945676-159945698 GGCCGCCGCGGGAGGGGGATTGG - Intergenic
919991435 1:202710454-202710476 CGCCGAGGCGGCAGAGGGAGGGG + Intergenic
921944881 1:220879677-220879699 CGCCACCGAGGGAGGAGGCGAGG - Exonic
922586388 1:226737494-226737516 CGCCGGCGGCGGAGCAGGAGCGG - Exonic
1065918033 10:30368445-30368467 AGACGCTGCGGGAGCAGGAGAGG - Intronic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1069695531 10:70382702-70382724 CGCCGCGGCGGGAGCAGGCTGGG + Intergenic
1070768619 10:79070061-79070083 CACCGCCGCCGGAGACGGAGAGG - Intronic
1071956832 10:90769974-90769996 AGCCGCTGCGGGAGCAGCAGTGG + Intronic
1072915855 10:99537005-99537027 GGCCGCCGGGGGAGAAGGGAGGG - Intergenic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1076374054 10:129971888-129971910 GGCGGCGGCGGGAGGAGGAGCGG - Intergenic
1076916332 10:133424524-133424546 CGCGGCCGAGCGGGAAGGAGCGG + Exonic
1076936439 10:133569319-133569341 CGCGGCCGAGCGGGAAGGAGCGG + Intronic
1077049953 11:562106-562128 AGCGGCTTCGGGAGAAGGAGCGG + Exonic
1077074666 11:694939-694961 CGCGGCCGCGGCAGGAGGCGAGG - Exonic
1080387866 11:31820153-31820175 GGTCGCCGAGGGAGAAGGTGCGG + Intronic
1081765387 11:45606679-45606701 CCCTGCGGCGGGAGAAGCAGGGG - Intergenic
1083079350 11:60073953-60073975 AGCGGCAGCGGGAGCAGGAGCGG + Intergenic
1083366547 11:62144971-62144993 CGCCACCCCAGGAGAAGGAGCGG + Exonic
1083970313 11:66070415-66070437 CGCCGCCGCGGGGGAAGCCTGGG + Intronic
1084680146 11:70662281-70662303 CGCCGGGACGGGAGAGGGAGGGG - Intronic
1088481040 11:110296625-110296647 CGCCTCCGCGGGAAAAGGCGGGG + Exonic
1091616419 12:2053788-2053810 AACCGCCGCGCGAGACGGAGCGG + Intronic
1092159847 12:6310383-6310405 CGCCGCCGGGGGAGGCGGCGAGG - Intergenic
1092821466 12:12357264-12357286 CTGGGCGGCGGGAGAAGGAGAGG - Exonic
1094337857 12:29380945-29380967 CGCCCCCGTGGGAGGTGGAGCGG + Intronic
1096078409 12:48818618-48818640 CCCCTCCCCGGGAGAAGGCGGGG - Intronic
1098217552 12:68236174-68236196 CCCCGCCTGGGGAGAGGGAGAGG + Intergenic
1098340355 12:69444694-69444716 CGCAGCAGGGAGAGAAGGAGAGG - Intergenic
1098595967 12:72273146-72273168 AGCCGCCGTCGGAGGAGGAGCGG + Exonic
1101466887 12:104958255-104958277 CGCAGCCGCGCGAGGAGGCGCGG - Intronic
1104697102 12:130872022-130872044 CGCCGGCGCGAGAGCAGGGGCGG - Exonic
1106756077 13:32824265-32824287 CGCCTCTGCCGGGGAAGGAGAGG - Intergenic
1107851386 13:44576466-44576488 CGCCGACGCGGCGGGAGGAGGGG - Exonic
1110436530 13:75482360-75482382 AGCTGCGGCGGGAGGAGGAGCGG - Intergenic
1112091863 13:96091041-96091063 CGCCGCCGGAGGAGTGGGAGCGG + Exonic
1113767491 13:112890221-112890243 CGTCGCCCTGGGGGAAGGAGCGG + Intergenic
1118607625 14:67515180-67515202 TCCCGGCGCGGGAGGAGGAGCGG - Exonic
1119743164 14:77027124-77027146 CGCCGCCGCTGAAGAAGAATTGG + Exonic
1120993451 14:90397826-90397848 CGCCCCCCGGGAAGAAGGAGGGG - Intronic
1122634467 14:103123588-103123610 CGCCGCGGCGGGGACAGGAGGGG + Exonic
1124431740 15:29614282-29614304 CGCCGCCGCAGAAGAGGGAGAGG + Intergenic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1128636129 15:69303662-69303684 GGCAGCCGTGGGAGAAGGAGTGG + Intronic
1129228749 15:74184815-74184837 CGCTGCAGTGGGAGAAGGTGGGG - Intronic
1129676051 15:77632845-77632867 AGCCGGCGCGGGAGCCGGAGCGG - Intronic
1129740240 15:77986460-77986482 CGCCGCGTCGGGACTAGGAGAGG - Intronic
1133443141 16:5837186-5837208 AGCCTCCGTGGGAGGAGGAGAGG - Intergenic
1136414750 16:30096235-30096257 CGCTGCGGCGGGAGGGGGAGGGG + Intronic
1141732157 16:85829955-85829977 CGCCGCAGCGGGAGGCGAAGGGG + Intergenic
1142480470 17:215605-215627 CACGGCCGCGGGGGCAGGAGAGG + Intronic
1142502257 17:339699-339721 CGACGCCTTGGGAGGAGGAGGGG - Intronic
1142594025 17:1020929-1020951 CACCTCCGAGGGAGCAGGAGTGG - Intronic
1142860126 17:2756030-2756052 CGCCCCCGCGGGAGGGGGACGGG - Intergenic
1143155501 17:4833679-4833701 CCCCGCCGCAGGGGAGGGAGCGG + Intronic
1143164174 17:4889720-4889742 CTCTGCGGCGGGAGGAGGAGCGG + Exonic
1146955856 17:36936106-36936128 CGCCGGCGCGGGGGAAGGAGTGG - Intergenic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148059989 17:44829910-44829932 GGCCAGAGCGGGAGAAGGAGGGG - Intronic
1151731502 17:75914182-75914204 AGCTGCGGCTGGAGAAGGAGAGG - Exonic
1151919144 17:77140862-77140884 CGCGGCCGCGGCCGAGGGAGCGG - Intronic
1153457525 18:5296263-5296285 CCCGCGCGCGGGAGAAGGAGTGG + Intronic
1153794390 18:8609472-8609494 CGCCGCCGGGAGAGGAGGAAGGG - Exonic
1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG + Intronic
1156149419 18:34224506-34224528 AGCCGCCGCGCGAGGAGGATGGG - Intronic
1156171760 18:34494063-34494085 CGGCGCCGCGGCAGCAGCAGGGG - Intronic
1157464245 18:47930623-47930645 CGCCGCCCGCGGGGAAGGAGGGG + Intronic
1158599850 18:58847686-58847708 CAGCTCCGCGGGAGAGGGAGCGG + Intergenic
1158954198 18:62523693-62523715 CGGCGCTGCGCGAGCAGGAGCGG + Exonic
1160454603 18:78992072-78992094 AGCCGCCCCGGGGGAAGGTGCGG + Exonic
1160704309 19:522833-522855 CGCCGCAGAGGCAGATGGAGAGG + Intergenic
1160864579 19:1251109-1251131 CGCCGGGGAGGGAGGAGGAGGGG + Intronic
1160930354 19:1567278-1567300 AGCCGCCGCGGGAGAAAGTTGGG - Intronic
1161470751 19:4455783-4455805 TGCCGCAGGGAGAGAAGGAGGGG + Intronic
1162337630 19:10071423-10071445 CGCAGCCCAGGGACAAGGAGGGG + Intergenic
1162752626 19:12838333-12838355 CACCCCGGCGGGAGAAGGGGCGG - Intronic
1165772708 19:38388234-38388256 CGGCGCCCGGGGGGAAGGAGAGG - Intergenic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1167356891 19:49010021-49010043 CGCGGGCGCGTGTGAAGGAGCGG - Exonic
1167889492 19:52528137-52528159 CGGCGCCTTGGGAGAAGGATGGG - Intronic
1168344233 19:55642618-55642640 CCCCGCCGCCGAGGAAGGAGTGG - Exonic
926914409 2:17878699-17878721 CGCCGCCGCGGCGGCAGGCGCGG + Intronic
927652291 2:24920039-24920061 CGCCGCCGCGGGTGCAGGGGAGG - Intergenic
931348850 2:61470874-61470896 CCCCGCAGCGGGAGGGGGAGAGG + Intergenic
937273504 2:120670111-120670133 AGCCGCTGAGGGAGCAGGAGGGG - Intergenic
938795991 2:134718786-134718808 CGCCCCAGCTGGAGGAGGAGCGG - Exonic
941029308 2:160493433-160493455 CGCCGCCGCCGGAAAGGGAGAGG - Exonic
948884673 2:240876765-240876787 CGCACCCGCGGGGGAAGGCGAGG + Intronic
948995470 2:241576137-241576159 GGCTGCAGCGGGAGGAGGAGAGG - Intergenic
1170150362 20:13221304-13221326 CGCCGCAGCTGGAGCGGGAGCGG - Intergenic
1172761690 20:37327882-37327904 CCCCGCAGCGGGGGGAGGAGAGG - Intergenic
1175962097 20:62642436-62642458 CGCCCCCGCCGCAGAGGGAGGGG - Exonic
1184114267 22:42413105-42413127 CTCAGCTGCTGGAGAAGGAGGGG - Intronic
1184342126 22:43891826-43891848 AGCCGGCGCCGGAGAAGGACAGG + Exonic
950386415 3:12663876-12663898 CCCCGCGGCGGGTGAGGGAGCGG + Exonic
950434038 3:12967866-12967888 CGGCGCCGCGGAAGAAGCACAGG + Intronic
952287333 3:31981383-31981405 GGCCGCGGCGGGAGGAGGGGCGG - Intronic
953392130 3:42539992-42540014 CGGGGCAGGGGGAGAAGGAGGGG - Intergenic
956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG + Intronic
966762278 3:183428678-183428700 ACCCGGCGCGGAAGAAGGAGGGG - Intronic
967511898 3:190322340-190322362 CGCCGCCGCTGGAGAAGCTCTGG + Exonic
968452459 4:681787-681809 CTGCGCCGCGGGAGGGGGAGCGG - Intronic
969114549 4:4862987-4863009 GGCCGCCGAGAGGGAAGGAGAGG - Exonic
969671491 4:8592644-8592666 TGCCGCTGGGGGAGGAGGAGGGG - Exonic
970332703 4:15002575-15002597 CGCGGCCGTGGTGGAAGGAGGGG - Intergenic
971195703 4:24470763-24470785 CGCCGCCGCGGCAGCAGCAGCGG - Intergenic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
973945344 4:55949163-55949185 CGCGGCCGCGGGAGGAAGTGAGG + Intronic
974929874 4:68349818-68349840 CGCAGCCGCGGCAGAAGCACGGG + Exonic
975796080 4:78007888-78007910 CGACGGAGAGGGAGAAGGAGAGG + Intergenic
978443968 4:108763111-108763133 CCCCGGCGGGGGAGGAGGAGGGG - Intergenic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
984928327 4:184825870-184825892 CACCGCCGCGGGAGCAGGCGCGG + Intronic
986321152 5:6633496-6633518 CGGCGGCGCGGGGGCAGGAGGGG - Exonic
986330453 5:6713426-6713448 CGACAGCGCGGGGGAAGGAGGGG - Intergenic
992399959 5:76403158-76403180 CTCCCCCGGGGGAGAAGGGGCGG + Intergenic
994171406 5:96662608-96662630 CGCCCCCGCGGGGCAGGGAGAGG + Intronic
995650422 5:114362409-114362431 CGCCGCCGGGCGAGGAGGTGCGG - Exonic
997292396 5:132747392-132747414 CGCCGCCGGGGGAGGTGGGGAGG - Intergenic
998193027 5:140043016-140043038 CGCCGCCACTGGAGAAGGGTCGG - Exonic
1002700687 5:181122436-181122458 GGCCGGCGGGGGAGAAGAAGCGG - Intergenic
1003112180 6:3259396-3259418 CGGGGCGGCGGGACAAGGAGAGG - Intronic
1005886897 6:30103787-30103809 CGCCTTTGCGGGAGAAGGAAAGG + Exonic
1006981589 6:38152211-38152233 TGCAGCAGCGGGAGAAGCAGAGG - Intronic
1007520727 6:42450616-42450638 GGCCTCCGCTGGTGAAGGAGTGG + Intronic
1009437565 6:63635824-63635846 CGGCGGCGCGGGAGCTGGAGAGG - Exonic
1013155729 6:107490040-107490062 GGCCGGCGCGGGAGGAGGGGAGG - Exonic
1013180440 6:107712780-107712802 CGCTGCAGCTGGAGAGGGAGTGG - Intronic
1014023430 6:116616898-116616920 CGGAGCCAGGGGAGAAGGAGAGG - Exonic
1014035771 6:116765435-116765457 CCCCGCCGCTGGAGTAGCAGGGG + Exonic
1018378818 6:163239623-163239645 GGCAGCCGTGGGAGCAGGAGGGG - Intronic
1018390180 6:163335905-163335927 CCCCGCCGCGGTGGCAGGAGAGG - Intergenic
1019358018 7:591124-591146 CCCCGCCGCGAGAGATGGACGGG - Intronic
1020210553 7:6154865-6154887 AGCCGGCCCGGGAGAGGGAGCGG + Exonic
1030121127 7:106112006-106112028 CGCCGCCCCGGGACTGGGAGTGG - Intronic
1030727174 7:112939664-112939686 CGCCGCCCCGGGAGCAGGAGCGG - Exonic
1035265990 7:157690574-157690596 CGCCCGCGCGGGAGGAGGTGGGG + Intronic
1036379411 8:8227671-8227693 CGCCGACGCGGGACCAGGGGCGG - Intergenic
1036723693 8:11200968-11200990 CGCCGCCGCCGCAGGTGGAGCGG - Exonic
1038554077 8:28494376-28494398 CGGGGCAGCGGGAGAAGGAGCGG + Intronic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1040471429 8:47738246-47738268 CGGGGCCGCGGGGGAAGGGGCGG + Exonic
1042591783 8:70403673-70403695 CGCGGCCCCGGGGGAAGGCGCGG + Intronic
1049405507 8:142450286-142450308 CGCCACCGCTGGAGAAGGCAGGG - Intronic
1049685353 8:143937225-143937247 CACAGCCCCGGGAGAAGGGGAGG - Exonic
1049803206 8:144527593-144527615 CGCCACCGCCGCAGTAGGAGAGG + Exonic
1055945264 9:81687750-81687772 CGCCGCCGTGGGGGAAGGGGCGG - Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1058467524 9:105244515-105244537 CGGCGGCCCGGGAGAGGGAGCGG + Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062569857 9:137180028-137180050 CGCCTCTGCAGGAGAGGGAGTGG - Intronic
1185644882 X:1609482-1609504 CGCGGCAGCGGCAGCAGGAGAGG - Intergenic
1185761300 X:2691417-2691439 CGCCGCCCCGGGTGAGCGAGCGG + Exonic
1187900883 X:24025686-24025708 CGGCGCCACGGGAGCGGGAGCGG + Intronic
1189398941 X:40647331-40647353 AGCCGCCGCGGCAGACGGCGCGG + Exonic
1190024575 X:46912228-46912250 CGGCGCCGCGGGTGCGGGAGCGG + Intergenic
1190713920 X:53088383-53088405 CGGCGCGGCGGGAAGAGGAGAGG - Exonic
1192447976 X:71224612-71224634 CACCGGCAGGGGAGAAGGAGGGG - Exonic
1192818059 X:74614709-74614731 AGGCTCCGCGGGAGGAGGAGGGG + Intergenic
1199649726 X:149939556-149939578 GGCAGCCGCGGGAGAAGCAGGGG + Intergenic