ID: 1155461737

View in Genome Browser
Species Human (GRCh38)
Location 18:26090965-26090987
Sequence CGAAGGGGGCGGGCCGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155461737_1155461748 5 Left 1155461737 18:26090965-26090987 CCCAAGCCGGCCCGCCCCCTTCG No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155461737 Original CRISPR CGAAGGGGGCGGGCCGGCTT GGG (reversed) Intronic