ID: 1155461748

View in Genome Browser
Species Human (GRCh38)
Location 18:26090993-26091015
Sequence TGGCAACTTGCCTCCCTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155461732_1155461748 30 Left 1155461732 18:26090940-26090962 CCCCTGTCACAGGAAATGCGAGC No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461743_1155461748 -9 Left 1155461743 18:26090979-26091001 CCCCCTTCGCGCCGTGGCAACTT No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461734_1155461748 28 Left 1155461734 18:26090942-26090964 CCTGTCACAGGAAATGCGAGCGG No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461741_1155461748 -5 Left 1155461741 18:26090975-26090997 CCCGCCCCCTTCGCGCCGTGGCA No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461738_1155461748 4 Left 1155461738 18:26090966-26090988 CCAAGCCGGCCCGCCCCCTTCGC No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461739_1155461748 -1 Left 1155461739 18:26090971-26090993 CCGGCCCGCCCCCTTCGCGCCGT No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461744_1155461748 -10 Left 1155461744 18:26090980-26091002 CCCCTTCGCGCCGTGGCAACTTG No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461742_1155461748 -6 Left 1155461742 18:26090976-26090998 CCGCCCCCTTCGCGCCGTGGCAA No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461733_1155461748 29 Left 1155461733 18:26090941-26090963 CCCTGTCACAGGAAATGCGAGCG No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201
1155461737_1155461748 5 Left 1155461737 18:26090965-26090987 CCCAAGCCGGCCCGCCCCCTTCG No data
Right 1155461748 18:26090993-26091015 TGGCAACTTGCCTCCCTCTCCGG 0: 1
1: 0
2: 1
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155461748 Original CRISPR TGGCAACTTGCCTCCCTCTC CGG Intronic