ID: 1155465788

View in Genome Browser
Species Human (GRCh38)
Location 18:26133873-26133895
Sequence CAACACAGCGTGCTACCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155465788_1155465796 14 Left 1155465788 18:26133873-26133895 CCGGGCGGTAGCACGCTGTGTTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1155465796 18:26133910-26133932 CTTGCCTCAGCTGCAGCAGCGGG 0: 1
1: 0
2: 2
3: 43
4: 515
1155465788_1155465795 13 Left 1155465788 18:26133873-26133895 CCGGGCGGTAGCACGCTGTGTTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1155465795 18:26133909-26133931 GCTTGCCTCAGCTGCAGCAGCGG 0: 1
1: 0
2: 3
3: 29
4: 283
1155465788_1155465799 25 Left 1155465788 18:26133873-26133895 CCGGGCGGTAGCACGCTGTGTTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1155465799 18:26133921-26133943 TGCAGCAGCGGGAAGCTCGGTGG 0: 1
1: 0
2: 1
3: 16
4: 147
1155465788_1155465798 22 Left 1155465788 18:26133873-26133895 CCGGGCGGTAGCACGCTGTGTTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1155465798 18:26133918-26133940 AGCTGCAGCAGCGGGAAGCTCGG 0: 1
1: 18
2: 14
3: 47
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155465788 Original CRISPR CAACACAGCGTGCTACCGCC CGG (reversed) Exonic
907448199 1:54523342-54523364 TAACACAGCGCACTACAGCCTGG - Intergenic
1084203823 11:67579405-67579427 CAACACAGCCTGCAGCCTCCAGG - Intergenic
1087936122 11:104036594-104036616 GAACACAACGTGCTACCTCAAGG + Exonic
1091231267 11:133989306-133989328 GGACACAGCGTGCTGCCGCCTGG - Intergenic
1096498119 12:52050404-52050426 CAACCCAGTGTGCCACCACCTGG + Intronic
1103884694 12:124191637-124191659 CAACACTCCGTGCTCCCTCCTGG + Intronic
1105779020 13:23690264-23690286 CACCACAGTGTGCCACAGCCTGG - Intergenic
1113562561 13:111293909-111293931 CTAAACAACGTGCTACTGCCAGG - Exonic
1118484229 14:66198609-66198631 TCACACAGGGTGCTACCCCCAGG - Intergenic
1139973109 16:70788526-70788548 CAAAACAGCGTACTAAGGCCTGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142790441 17:2260187-2260209 CAACATGGCCTGCTACAGCCTGG + Intronic
1143446983 17:7015437-7015459 CAACACAGCCTGCAGCCGTCTGG - Intronic
1146657360 17:34642600-34642622 AATCACAGCGTGCTGCAGCCTGG + Intergenic
1155465788 18:26133873-26133895 CAACACAGCGTGCTACCGCCCGG - Exonic
1161102473 19:2427911-2427933 CTATACAGCGTGTTGCCGCCGGG + Intronic
1163323496 19:16588193-16588215 CCACCCAGCGTGCTATCACCAGG - Intronic
1167281377 19:48571061-48571083 CACCACTGCGTGCTCCAGCCTGG - Intronic
927638246 2:24831452-24831474 CACCACAGCCTGCCACAGCCTGG + Intronic
927689147 2:25195321-25195343 CAACACAGCAAGCCACAGCCAGG + Intergenic
935059281 2:99593743-99593765 CAACAGAGCGAGCCACCGCAAGG - Exonic
1174946283 20:54989212-54989234 AAACACATCTTGCTACAGCCTGG - Intergenic
1183354685 22:37351771-37351793 CAACACAGAGGGCTGCCGCGGGG + Intergenic
953350785 3:42214232-42214254 CAACACAGGGTGCTCCCTCAAGG - Intronic
979014192 4:115411978-115412000 AATCACAGCTTGCTACAGCCTGG + Intergenic
994045503 5:95305088-95305110 TAACACAGCATGCTGCCTCCAGG - Intergenic
997373821 5:133382963-133382985 GAACAGAGCGTGCAACTGCCTGG + Intronic
1001534487 5:172489035-172489057 GGACACAGCCTGCTACTGCCAGG - Intergenic
1019666155 7:2253128-2253150 CAACACAGGGAGATGCCGCCAGG + Exonic
1026484128 7:70803229-70803251 CAAAACAGCATGGTACTGCCAGG + Intergenic
1037752607 8:21692633-21692655 CAACACTCCGTGCTACAGTCAGG + Exonic
1044700835 8:94964092-94964114 TAATACAGGGTCCTACCGCCAGG - Intronic
1048103583 8:131382204-131382226 CAATACAGAGAGCTACAGCCAGG - Intergenic
1049644611 8:143730492-143730514 CTACAAAGAGTACTACCGCCTGG - Exonic
1054869299 9:70034752-70034774 CAACACAGAGTGTTAGCGCCTGG + Intergenic