ID: 1155467219 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:26150419-26150441 |
| Sequence | TGCTTGAGCCCAGGAGTTTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155467219_1155467227 | 9 | Left | 1155467219 | 18:26150419-26150441 | CCTTAAACTCCTGGGCTCAAGCA | No data | ||
| Right | 1155467227 | 18:26150451-26150473 | CCGCAGCCTCCCAAGTAGCTAGG | No data | ||||
| 1155467219_1155467229 | 17 | Left | 1155467219 | 18:26150419-26150441 | CCTTAAACTCCTGGGCTCAAGCA | No data | ||
| Right | 1155467229 | 18:26150459-26150481 | TCCCAAGTAGCTAGGACTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155467219 | Original CRISPR | TGCTTGAGCCCAGGAGTTTA AGG (reversed) | Intronic | ||