ID: 1155467219

View in Genome Browser
Species Human (GRCh38)
Location 18:26150419-26150441
Sequence TGCTTGAGCCCAGGAGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467219_1155467227 9 Left 1155467219 18:26150419-26150441 CCTTAAACTCCTGGGCTCAAGCA No data
Right 1155467227 18:26150451-26150473 CCGCAGCCTCCCAAGTAGCTAGG No data
1155467219_1155467229 17 Left 1155467219 18:26150419-26150441 CCTTAAACTCCTGGGCTCAAGCA No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467219 Original CRISPR TGCTTGAGCCCAGGAGTTTA AGG (reversed) Intronic