ID: 1155467220

View in Genome Browser
Species Human (GRCh38)
Location 18:26150428-26150450
Sequence CGGGGGGATTGCTTGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467220_1155467227 0 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG No data
Right 1155467227 18:26150451-26150473 CCGCAGCCTCCCAAGTAGCTAGG No data
1155467220_1155467232 23 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467220_1155467229 8 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467220 Original CRISPR CGGGGGGATTGCTTGAGCCC AGG (reversed) Intronic