ID: 1155467222

View in Genome Browser
Species Human (GRCh38)
Location 18:26150445-26150467
Sequence TACTTGGGAGGCTGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14748
Summary {0: 2, 1: 60, 2: 2338, 3: 4877, 4: 7471}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467222_1155467232 6 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA 0: 2
1: 60
2: 2338
3: 4877
4: 7471
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467222_1155467229 -9 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA 0: 2
1: 60
2: 2338
3: 4877
4: 7471
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467222 Original CRISPR TACTTGGGAGGCTGCGGCGG GGG (reversed) Intronic
Too many off-targets to display for this crispr