ID: 1155467222

View in Genome Browser
Species Human (GRCh38)
Location 18:26150445-26150467
Sequence TACTTGGGAGGCTGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467222_1155467232 6 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467222_1155467229 -9 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467222 Original CRISPR TACTTGGGAGGCTGCGGCGG GGG (reversed) Intronic