ID: 1155467229

View in Genome Browser
Species Human (GRCh38)
Location 18:26150459-26150481
Sequence TCCCAAGTAGCTAGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467219_1155467229 17 Left 1155467219 18:26150419-26150441 CCTTAAACTCCTGGGCTCAAGCA No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data
1155467222_1155467229 -9 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data
1155467221_1155467229 -8 Left 1155467221 18:26150444-26150466 CCCCCCGCCGCAGCCTCCCAAGT No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data
1155467220_1155467229 8 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data
1155467223_1155467229 -10 Left 1155467223 18:26150446-26150468 CCCCGCCGCAGCCTCCCAAGTAG No data
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467229 Original CRISPR TCCCAAGTAGCTAGGACTAC AGG Intronic