ID: 1155467229

View in Genome Browser
Species Human (GRCh38)
Location 18:26150459-26150481
Sequence TCCCAAGTAGCTAGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693625
Summary {0: 2484, 1: 49947, 2: 165173, 3: 227638, 4: 248383}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467223_1155467229 -10 Left 1155467223 18:26150446-26150468 CCCCGCCGCAGCCTCCCAAGTAG 0: 1
1: 64
2: 2784
3: 5630
4: 7919
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383
1155467222_1155467229 -9 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA 0: 2
1: 60
2: 2338
3: 4877
4: 7471
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383
1155467221_1155467229 -8 Left 1155467221 18:26150444-26150466 CCCCCCGCCGCAGCCTCCCAAGT 0: 2
1: 707
2: 16649
3: 58926
4: 172388
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383
1155467219_1155467229 17 Left 1155467219 18:26150419-26150441 CCTTAAACTCCTGGGCTCAAGCA 0: 106
1: 3547
2: 11983
3: 25253
4: 48015
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383
1155467220_1155467229 8 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG 0: 15
1: 1198
2: 16426
3: 53764
4: 138079
Right 1155467229 18:26150459-26150481 TCCCAAGTAGCTAGGACTACAGG 0: 2484
1: 49947
2: 165173
3: 227638
4: 248383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467229 Original CRISPR TCCCAAGTAGCTAGGACTAC AGG Intronic
Too many off-targets to display for this crispr