ID: 1155467232

View in Genome Browser
Species Human (GRCh38)
Location 18:26150474-26150496
Sequence ACTACAGGCATGTGCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4422
Summary {0: 2, 1: 79, 2: 497, 3: 1240, 4: 2604}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467224_1155467232 4 Left 1155467224 18:26150447-26150469 CCCGCCGCAGCCTCCCAAGTAGC 0: 164
1: 76262
2: 177845
3: 217667
4: 222048
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467231_1155467232 -10 Left 1155467231 18:26150461-26150483 CCAAGTAGCTAGGACTACAGGCA 0: 1787
1: 38537
2: 138669
3: 149626
4: 133353
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467222_1155467232 6 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA 0: 2
1: 60
2: 2338
3: 4877
4: 7471
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467226_1155467232 0 Left 1155467226 18:26150451-26150473 CCGCAGCCTCCCAAGTAGCTAGG 0: 4832
1: 100351
2: 211784
3: 254916
4: 268415
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467220_1155467232 23 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG 0: 15
1: 1198
2: 16426
3: 53764
4: 138079
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467228_1155467232 -6 Left 1155467228 18:26150457-26150479 CCTCCCAAGTAGCTAGGACTACA 0: 2581
1: 50225
2: 165854
3: 228164
4: 248116
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467225_1155467232 3 Left 1155467225 18:26150448-26150470 CCGCCGCAGCCTCCCAAGTAGCT 0: 49
1: 13150
2: 28503
3: 43794
4: 110227
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467223_1155467232 5 Left 1155467223 18:26150446-26150468 CCCCGCCGCAGCCTCCCAAGTAG 0: 1
1: 64
2: 2784
3: 5630
4: 7919
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467230_1155467232 -9 Left 1155467230 18:26150460-26150482 CCCAAGTAGCTAGGACTACAGGC 0: 1612
1: 38296
2: 169752
3: 262274
4: 234190
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604
1155467221_1155467232 7 Left 1155467221 18:26150444-26150466 CCCCCCGCCGCAGCCTCCCAAGT 0: 2
1: 707
2: 16649
3: 58926
4: 172388
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG 0: 2
1: 79
2: 497
3: 1240
4: 2604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467232 Original CRISPR ACTACAGGCATGTGCCAGCA TGG Intronic
Too many off-targets to display for this crispr