ID: 1155467232

View in Genome Browser
Species Human (GRCh38)
Location 18:26150474-26150496
Sequence ACTACAGGCATGTGCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155467222_1155467232 6 Left 1155467222 18:26150445-26150467 CCCCCGCCGCAGCCTCCCAAGTA No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467231_1155467232 -10 Left 1155467231 18:26150461-26150483 CCAAGTAGCTAGGACTACAGGCA No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467225_1155467232 3 Left 1155467225 18:26150448-26150470 CCGCCGCAGCCTCCCAAGTAGCT No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467228_1155467232 -6 Left 1155467228 18:26150457-26150479 CCTCCCAAGTAGCTAGGACTACA No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467224_1155467232 4 Left 1155467224 18:26150447-26150469 CCCGCCGCAGCCTCCCAAGTAGC No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467221_1155467232 7 Left 1155467221 18:26150444-26150466 CCCCCCGCCGCAGCCTCCCAAGT No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467230_1155467232 -9 Left 1155467230 18:26150460-26150482 CCCAAGTAGCTAGGACTACAGGC No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467223_1155467232 5 Left 1155467223 18:26150446-26150468 CCCCGCCGCAGCCTCCCAAGTAG No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467220_1155467232 23 Left 1155467220 18:26150428-26150450 CCTGGGCTCAAGCAATCCCCCCG No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data
1155467226_1155467232 0 Left 1155467226 18:26150451-26150473 CCGCAGCCTCCCAAGTAGCTAGG No data
Right 1155467232 18:26150474-26150496 ACTACAGGCATGTGCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155467232 Original CRISPR ACTACAGGCATGTGCCAGCA TGG Intronic