ID: 1155468112

View in Genome Browser
Species Human (GRCh38)
Location 18:26161670-26161692
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1918
Summary {0: 3, 1: 10, 2: 54, 3: 410, 4: 1441}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155468112_1155468114 10 Left 1155468112 18:26161670-26161692 CCAGGCTGTAGTGCACTATGATC 0: 3
1: 10
2: 54
3: 410
4: 1441
Right 1155468114 18:26161703-26161725 ATAGCCACTGCACTGCAGCCTGG 0: 17
1: 565
2: 2187
3: 21838
4: 207494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155468112 Original CRISPR GATCATAGTGCACTACAGCC TGG (reversed) Intronic
900282949 1:1883204-1883226 GATCATGGTTCACTGCAGCCTGG - Intronic
900357068 1:2270122-2270144 GGTCATTGTCCCCTACAGCCAGG + Intronic
900976263 1:6018507-6018529 GATCATGGCTCACTGCAGCCTGG + Intronic
901434915 1:9241467-9241489 GATCATGGCTCACTGCAGCCTGG + Intronic
902142820 1:14370748-14370770 GATCATGGCTCACTGCAGCCTGG + Intergenic
902151389 1:14446128-14446150 GATGATAGCTCACTGCAGCCTGG - Intergenic
902349684 1:15845346-15845368 AATCATAGTGCACTACAGCTTGG + Intergenic
902521432 1:17019797-17019819 GATCATAGTTCACTGTGGCCTGG + Intronic
902521661 1:17021374-17021396 AATCATAGCTCACTGCAGCCTGG - Intronic
902522153 1:17025473-17025495 AATCACAGTTCACTGCAGCCTGG + Intronic
902667091 1:17947189-17947211 GATCACAGTTCACTGCAGCCTGG + Intergenic
902827207 1:18984323-18984345 GATCATAGCTCACTGCAGCCTGG - Intergenic
903005823 1:20298074-20298096 GATCATATCTCACTGCAGCCTGG + Intronic
903113569 1:21159391-21159413 GATCAAACTTCACTTCAGCCTGG + Intronic
903148989 1:21391876-21391898 AAGCAGAGTGCACTCCAGCCTGG - Intergenic
903204278 1:21768863-21768885 AATCATAGCTCACTGCAGCCTGG + Intronic
903416759 1:23188825-23188847 GATCATGGCATACTACAGCCTGG - Intergenic
903591508 1:24459604-24459626 GAGCATAGGGCTTTACAGCCAGG - Intronic
903641938 1:24866113-24866135 GATCGTGGTTCACTGCAGCCTGG - Intergenic
903651001 1:24922014-24922036 GATCATAGCTCACTGCAGCCTGG + Intronic
903858027 1:26348484-26348506 GATCATAGCTCATTGCAGCCTGG - Intronic
903904070 1:26671165-26671187 GGTGAGAGTGCACTCCAGCCTGG - Intergenic
904110592 1:28123056-28123078 GATCAAAGCTCACTGCAGCCAGG + Intergenic
904178193 1:28646209-28646231 AATCATAGCTCACTGCAGCCTGG - Intergenic
904180375 1:28662593-28662615 AATCATAATTCACTATAGCCTGG - Intergenic
904502232 1:30920309-30920331 GATCATGGCGCACTGCAGCCAGG - Intergenic
904669197 1:32150174-32150196 CATGCTACTGCACTACAGCCTGG - Intronic
904693640 1:32314255-32314277 GATCACAGCTCACTGCAGCCTGG + Intronic
904760020 1:32796429-32796451 GATCATGGCTCACTGCAGCCAGG + Intronic
905021791 1:34821206-34821228 CATACTATTGCACTACAGCCTGG + Intronic
905053504 1:35073495-35073517 GATCATAGCTCACTGCAGCCTGG - Intronic
905065435 1:35177169-35177191 CATGCCAGTGCACTACAGCCTGG + Intronic
905112201 1:35603954-35603976 CATCATAGCTCACTGCAGCCTGG - Intronic
905409653 1:37759715-37759737 GATCATAGTGCATTACAGCCTGG - Intronic
905417871 1:37816794-37816816 GATCACAGCTCACTGCAGCCTGG - Intronic
905551982 1:38849247-38849269 AATCATAGCTCACTGCAGCCTGG + Intronic
905738291 1:40346897-40346919 TATGATTGTGCACTCCAGCCTGG - Intronic
905738292 1:40346913-40346935 AATCATAGCTCACTGCAGCCTGG + Intronic
906220251 1:44072626-44072648 GATCATAGCTCTCTGCAGCCTGG - Intergenic
906230267 1:44156703-44156725 AATCATAGCTCACTGCAGCCCGG + Intergenic
906270577 1:44474641-44474663 GATCATAGCTCACTGCAGCCTGG - Intronic
906404702 1:45532690-45532712 CATCATAGCTCACTGCAGCCTGG + Intergenic
906518651 1:46454312-46454334 AATCATAGTTCACCGCAGCCTGG - Intergenic
906630681 1:47364835-47364857 GATCATAGCTCACTACATCCTGG + Intronic
906723830 1:48029099-48029121 GATCGCACTGCACTCCAGCCTGG - Intergenic
906924220 1:50097152-50097174 GATCATGGCTCACTGCAGCCTGG - Intronic
906965890 1:50456156-50456178 AATTATAGTGCACTACAGCTTGG + Intronic
907164212 1:52395933-52395955 GATCACAGTGCACTATAGCCTGG - Intronic
907181613 1:52575515-52575537 GATCATAGTTCACTGTAGCCTGG + Intergenic
907209173 1:52804200-52804222 CATCCTACTGCACTCCAGCCTGG + Intronic
907346831 1:53788851-53788873 CATAACACTGCACTACAGCCTGG + Intronic
907368697 1:53983347-53983369 GATCATAGCTCACTGCAGCCTGG + Intergenic
907448199 1:54523342-54523364 TAACACAGCGCACTACAGCCTGG - Intergenic
907688295 1:56635991-56636013 AATCATAGCTCACTGCAGCCTGG + Intronic
907690754 1:56663157-56663179 AATCATAGCTCACTGCAGCCTGG + Intronic
908181873 1:61613907-61613929 GATGACACTGCACTCCAGCCTGG + Intergenic
908197886 1:61763464-61763486 GATCATAGCTCACTGCAACCTGG - Intronic
908238305 1:62168307-62168329 CTTGATCGTGCACTACAGCCTGG + Intergenic
908536587 1:65084054-65084076 GATCACACTGTACTCCAGCCTGG + Intergenic
908538401 1:65100190-65100212 CATGCTACTGCACTACAGCCTGG + Intergenic
908860394 1:68479735-68479757 GATCATAGCTCACTGCACCCTGG - Intronic
909091630 1:71233059-71233081 GATCATGGCTCACTGCAGCCTGG - Intergenic
909253618 1:73390124-73390146 GCTCTTAGTGCATTACAGCCTGG + Intergenic
909378043 1:74962617-74962639 TATCACAGTTCACTGCAGCCTGG + Intergenic
909524141 1:76603736-76603758 AATCACAGCTCACTACAGCCTGG + Intronic
909615390 1:77603118-77603140 TATCCTACTGCACTCCAGCCTGG - Intronic
910258332 1:85272295-85272317 GATCATAGCTCACTGCAGCCTGG + Intronic
910585804 1:88878228-88878250 GATTTCAGTGCACTCCAGCCTGG + Intronic
910749187 1:90609636-90609658 GATCATAGCTCATTGCAGCCTGG - Intergenic
910762273 1:90745522-90745544 AATCATAGCTCACTGCAGCCTGG + Intergenic
910826029 1:91408064-91408086 GATCACAGCTCACTGCAGCCTGG - Intergenic
911441725 1:97935108-97935130 GATCATAGCTCACTGAAGCCTGG - Intergenic
911892299 1:103386881-103386903 GATTATGGTGCCCTACATCCTGG + Intergenic
912324507 1:108745176-108745198 GATCATAGCTCACTGCAGCCTGG + Intergenic
912338182 1:108882993-108883015 AATCATAGCACACTGCAGCCTGG - Intronic
912364907 1:109125437-109125459 GATTGTGCTGCACTACAGCCTGG - Intronic
912376944 1:109217624-109217646 GATCACAGCTCACTGCAGCCTGG + Intronic
912403000 1:109411684-109411706 GATCATAGCTCACTACAGCCTGG + Intronic
912545573 1:110448781-110448803 GATTATAGCTCACTGCAGCCTGG - Intergenic
912672393 1:111642827-111642849 GATCACACTACACTCCAGCCTGG - Intronic
912769674 1:112452234-112452256 GATCATAGCACCCTATAGCCTGG + Intronic
912838633 1:113019294-113019316 AATCATAGCACACTGCAGCCTGG + Intergenic
912925611 1:113910565-113910587 GATCACAGCTCACTGCAGCCTGG + Intronic
913009127 1:114665201-114665223 AATCATAGCTCACTGCAGCCTGG - Intronic
913026513 1:114847914-114847936 GATCAAACTGCACTACAGAAGGG + Intergenic
913184132 1:116352811-116352833 GATCACAGCTCACTGCAGCCTGG - Intergenic
913480660 1:119286179-119286201 GATCACACTGCACTGCAGCCTGG - Intergenic
914003538 1:143712827-143712849 AATGATAGTTCACTGCAGCCTGG + Intergenic
914094754 1:144535297-144535319 AATTATAGTTCACTGCAGCCTGG + Intergenic
914199235 1:145470133-145470155 CATCATAGGTCACTGCAGCCTGG + Intergenic
914253763 1:145943974-145943996 GATCATAACTCACTGCAGCCTGG - Intronic
914260131 1:145992044-145992066 GATCATACTACACTCCAGCCTGG + Intergenic
914303768 1:146398601-146398623 AATTATAGTTCACTGCAGCCTGG - Intergenic
914478347 1:148043269-148043291 CATCATAGGTCACTGCAGCCTGG + Intergenic
914502504 1:148259540-148259562 TGTCATAGCTCACTACAGCCTGG - Intergenic
914504302 1:148275318-148275340 GCACATATTGCACTCCAGCCTGG + Intergenic
914515977 1:148374578-148374600 AATCATAGTTCACTGCAGCCTGG + Intergenic
914713998 1:150239123-150239145 CATGATATTGCACTCCAGCCTGG + Intergenic
914807855 1:151004685-151004707 GGTGACACTGCACTACAGCCTGG + Intronic
914826573 1:151141830-151141852 CATCACAGAGCACTACATCCTGG + Intronic
914872815 1:151489613-151489635 GCTAATAGCTCACTACAGCCTGG + Intergenic
915171225 1:153978773-153978795 CATCATAGCGCATTACAGCCTGG + Intergenic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
915353695 1:155242662-155242684 GATCACACTGCACTCCAGCCTGG - Intronic
915414917 1:155734249-155734271 GGTGCTACTGCACTACAGCCTGG - Intronic
915544740 1:156590542-156590564 GATCATGGCTCACTGCAGCCTGG - Intergenic
915549136 1:156622481-156622503 GATCACAGTGCACTACAGTGTGG + Intronic
915911314 1:159917352-159917374 CATGCTACTGCACTACAGCCTGG + Intergenic
916358769 1:163943626-163943648 GATCACAGCTCACTGCAGCCTGG - Intergenic
916419465 1:164622866-164622888 GAGCCAAGTGCACTCCAGCCTGG - Intronic
916670191 1:167010509-167010531 AATCATAGCTCACTGCAGCCTGG + Intronic
916717867 1:167460335-167460357 GATCTTGGTTCACTGCAGCCTGG - Intronic
916723806 1:167505194-167505216 GATCATAGCTCACTGCAGCCTGG + Intronic
916802084 1:168225505-168225527 GGTCATAGCTCATTACAGCCTGG + Intergenic
917082241 1:171268150-171268172 GATCATGGCTCACTGCAGCCTGG + Intronic
917106636 1:171498865-171498887 GATCATCGCTCACTGCAGCCTGG + Intronic
917330976 1:173879905-173879927 GATGCTACTGCACTCCAGCCTGG + Intronic
917342263 1:173992189-173992211 GATCGTGCTGCACTCCAGCCTGG - Intronic
917429983 1:174956262-174956284 CGTCATAGTGCACTGCAGCCTGG + Intronic
917487930 1:175472070-175472092 GATCACAGCTCACTGCAGCCTGG - Intronic
917542608 1:175929395-175929417 GATCACAGCTCACTGCAGCCTGG + Intergenic
917550768 1:176025822-176025844 GATCACAGCTCACTGCAGCCTGG - Intronic
917567420 1:176227011-176227033 GAGCCTACTGCACTCCAGCCTGG + Intergenic
917742921 1:177978655-177978677 GATCATACTGCACTCAAGCCTGG + Intronic
917849962 1:179053368-179053390 GATCATAGCTCCCTGCAGCCTGG - Intronic
917885915 1:179384807-179384829 AATCACAGTGTACTCCAGCCTGG - Intronic
918012973 1:180604796-180604818 GATTATAGCTCACTGCAGCCTGG - Intergenic
918322896 1:183381651-183381673 CATGCTAGTGCACTCCAGCCTGG + Intronic
918505246 1:185246693-185246715 GATCATAGCTCACTGCAGCCTGG + Intronic
918510714 1:185310810-185310832 GATCATAGCTCACTGCAGCCTGG - Intronic
918679570 1:187334943-187334965 GATCACAGTTCACTGCAACCTGG - Intergenic
918929801 1:190839926-190839948 CATCATGGTGCACTGCAGCCTGG + Intergenic
919646109 1:200096135-200096157 TAAGATAGTGCACTCCAGCCTGG - Intronic
919673561 1:200359788-200359810 GATCATAGTACACTACAGCCTGG - Intergenic
919680069 1:200425454-200425476 CATCATAGTGCCCTGCCGCCTGG + Intergenic
919686179 1:200485650-200485672 AATCATAGTGCACTGCAACCTGG - Intergenic
919871834 1:201827966-201827988 GATGACAGCACACTACAGCCTGG + Intergenic
919907051 1:202085404-202085426 GATCAAAGTGCACTGCAGCTTGG - Intergenic
920000921 1:202798155-202798177 CATCATGCTGCACTCCAGCCTGG + Intronic
920129670 1:203722266-203722288 GATCATGGCTCACTGCAGCCTGG - Intronic
920636522 1:207709791-207709813 CATGATACTGCACTCCAGCCTGG + Intronic
920916305 1:210260754-210260776 GATCATGGCTCACTGCAGCCTGG + Intergenic
921123038 1:212153206-212153228 GATCATGGTTAACTGCAGCCTGG - Intergenic
921155536 1:212435412-212435434 AGTCATGGTGCACTAGAGCCTGG + Intronic
921174605 1:212583296-212583318 GCTCATAGTGCACTACACTCTGG + Intronic
921194978 1:212747096-212747118 GATCGCACTGCACTCCAGCCTGG + Intronic
921251388 1:213301631-213301653 AATCATAGCTCACTGCAGCCTGG - Intergenic
921379344 1:214507913-214507935 AATCATAGCTCACTGCAGCCTGG - Intronic
921522696 1:216176299-216176321 AATGATAGCTCACTACAGCCTGG + Intronic
921571723 1:216787556-216787578 GATACTACTGCACTCCAGCCTGG + Intronic
921602159 1:217117517-217117539 GATCATGGCTCACTACAGCTTGG - Intronic
921711614 1:218378670-218378692 GACCATAGCTCACTGCAGCCTGG + Intronic
922247715 1:223817116-223817138 AATCACACTGCACTCCAGCCTGG + Intronic
922333642 1:224600573-224600595 AATCATAGTGCACTGCAGCCTGG + Intronic
922439168 1:225637855-225637877 GATCATAGCTCACTGCAACCTGG - Intronic
922532504 1:226355180-226355202 GATCACAGTTCACTGCAGGCCGG + Intergenic
922543189 1:226434280-226434302 GATCATAGCACACTATAACCTGG - Intergenic
922543895 1:226440576-226440598 AATCATAGCTCACTGCAGCCTGG + Intergenic
922590365 1:226771189-226771211 AATCATAGCTCACTGCAGCCTGG + Intergenic
922591470 1:226780409-226780431 CATGCTACTGCACTACAGCCTGG + Intergenic
922653912 1:227364286-227364308 GATCACAGTTCACTGCAGCCTGG - Intergenic
922781804 1:228258298-228258320 GATCATGGCTCACTGCAGCCTGG - Intronic
923110642 1:230887222-230887244 AAACATAGCGAACTACAGCCTGG + Intergenic
923142428 1:231172019-231172041 AATCATAGCACACCACAGCCTGG - Intronic
923221540 1:231898887-231898909 GATGCAAGTGCACTCCAGCCTGG + Intronic
923351053 1:233107320-233107342 GATCACAGCTCACTGCAGCCTGG - Intronic
923559653 1:235028925-235028947 GAGCCAAGTGCACTCCAGCCTGG - Intergenic
923574385 1:235144679-235144701 AGTCATAGTCCACTATAGCCTGG - Intronic
923654772 1:235906021-235906043 AATCATAGCTCACTGCAGCCTGG - Intergenic
923695407 1:236245033-236245055 GATGTCAGTGCACTCCAGCCTGG - Intronic
923839874 1:237658455-237658477 GATCATACCTCACTGCAGCCTGG + Intronic
923963351 1:239107720-239107742 CATCACACTGCACTCCAGCCTGG - Intergenic
924020016 1:239771042-239771064 CATCCTACTGCACTCCAGCCTGG + Intronic
924058590 1:240147556-240147578 AATCATAGCTCACTGCAGCCTGG + Intronic
924150018 1:241120411-241120433 TATCACAGTTCACTACCGCCTGG + Intronic
924187476 1:241509708-241509730 GAGCATAGCTCACTGCAGCCTGG - Intronic
924415620 1:243853305-243853327 GATCATAGCTCACTGTAGCCTGG + Intergenic
924464671 1:244289453-244289475 GATCAATGTTCACTGCAGCCTGG - Intergenic
924474789 1:244373454-244373476 GATCACACTGCACTATAGCCTGG + Intronic
924507044 1:244695839-244695861 GATCATAGTTCATTGCAGCTGGG + Intronic
924550144 1:245068505-245068527 GATCATAGCTCACTGCAGCCTGG + Intronic
924726115 1:246672559-246672581 GATCATAGTTCACTGCAGTCTGG - Intergenic
924813296 1:247421931-247421953 GGTCATAGCTCACTCCAGCCTGG - Intronic
1062795470 10:341811-341833 AATCATAGCTCACTGCAGCCGGG - Intronic
1063292477 10:4763626-4763648 GATCATAGCTCACTGCAGTCTGG - Intergenic
1063719995 10:8570460-8570482 CATCATAGCTCACTGCAGCCTGG + Intergenic
1063948062 10:11196602-11196624 GGTTATACTGCACTCCAGCCTGG + Intronic
1064133314 10:12729561-12729583 CATCATAGCTCACTGCAGCCCGG - Intronic
1064153103 10:12881543-12881565 AATCATAGTTCACTGCAACCTGG - Intergenic
1064238970 10:13607457-13607479 GATCATGCTGAACTCCAGCCTGG - Intronic
1064293193 10:14053939-14053961 GATCATAACTCACTGCAGCCTGG - Intronic
1064304063 10:14149568-14149590 CATCATAGCTCACTGCAGCCTGG + Intronic
1064379448 10:14827846-14827868 GATGATACTGCACTCTAGCCTGG + Intronic
1064495845 10:15909570-15909592 GATCATAGCTCACTGCAGCCTGG + Intergenic
1064640529 10:17411228-17411250 GATCGCACTGCACTCCAGCCTGG - Intronic
1064641283 10:17418122-17418144 GATCAAAGCTCACTGCAGCCTGG + Intronic
1064716447 10:18181678-18181700 AGTCATAGTTCACTGCAGCCTGG + Intronic
1064843579 10:19624989-19625011 GATCATAGCTCACTACAGCCTGG - Intronic
1064991004 10:21256771-21256793 GATCAGAGCTCACTACAGCCTGG - Intergenic
1065165566 10:22973253-22973275 CATCCCAGTGCACTCCAGCCTGG + Intronic
1065212677 10:23419452-23419474 GATCATAGCTCACTGCAGCCTGG - Intergenic
1065337740 10:24671786-24671808 GATCATAGTTCACTGCAGACTGG + Intronic
1065351479 10:24799485-24799507 GATGATACTGCACTCCAGCCTGG + Intergenic
1065380866 10:25088513-25088535 AATCATAGCTCACTGCAGCCTGG - Intergenic
1065620381 10:27575105-27575127 AATCATAGCTTACTACAGCCTGG + Intergenic
1065715707 10:28565436-28565458 AATCATAGCTCACTGCAGCCTGG + Intronic
1065726487 10:28672255-28672277 GATCTTAGTTCACTGCAGCCTGG + Intergenic
1065742832 10:28812628-28812650 GATCATAGCTCACTGCAGCCTGG - Intergenic
1065823638 10:29550374-29550396 TATCATAGCTCACTGCAGCCTGG - Intronic
1066042310 10:31562139-31562161 AATCATAGCTCACTGCAGCCTGG - Intergenic
1066235699 10:33482160-33482182 TATGACACTGCACTACAGCCTGG - Intergenic
1066327992 10:34385175-34385197 CATGCTATTGCACTACAGCCTGG - Intronic
1066336124 10:34480299-34480321 GATCACAGCTCACTGCAGCCTGG + Intronic
1066627965 10:37428607-37428629 AATCACAGTTCACTGCAGCCTGG - Intergenic
1066963060 10:42238277-42238299 GATCACAGCTCACTGCAGCCTGG - Intergenic
1067136951 10:43617967-43617989 GATCACATGGCACTCCAGCCTGG - Intergenic
1067726962 10:48777682-48777704 AATCATAGTTCACTGCAGCCTGG - Intronic
1067748064 10:48951478-48951500 GATCATAGTTCATAGCAGCCTGG + Intronic
1067869393 10:49943279-49943301 GATTATAGTTCACTGAAGCCTGG + Intronic
1067932349 10:50575478-50575500 CATCATAGCTCACTGCAGCCTGG - Intronic
1068108283 10:52647107-52647129 GATCATAGCTCACTGCAGCCTGG - Intergenic
1068674362 10:59754815-59754837 CATGATACTGCACTTCAGCCTGG - Intergenic
1068994513 10:63187501-63187523 GATCATGGCTCACCACAGCCTGG + Intronic
1069028348 10:63568719-63568741 CATCATAGTTCACTGTAGCCTGG + Intronic
1069398068 10:68011104-68011126 CATACTAGTGCACTCCAGCCTGG - Intronic
1069441713 10:68434584-68434606 GATCACAGTTCACTGCAGCCTGG - Intronic
1069513529 10:69059494-69059516 GACCATAGCTCACTGCAGCCTGG + Intergenic
1069533366 10:69235059-69235081 GATCACAGCCCACTGCAGCCTGG - Intronic
1069605508 10:69736551-69736573 TATCATAGTTGACTGCAGCCTGG - Intergenic
1069718627 10:70536233-70536255 GATCATAGCCCACTGCAGCCTGG - Intronic
1069974431 10:72201211-72201233 GAACACAGTTCACTGCAGCCTGG + Intronic
1070068360 10:73060505-73060527 GATCATGGTGCACTACAGCCTGG - Intronic
1070092591 10:73302944-73302966 GATCATAGCTCACTGCAGCCTGG + Intronic
1070189087 10:74094866-74094888 GATCATAGCTCACTACAGACTGG - Intronic
1070203324 10:74229971-74229993 GATCATAGCTCACTGCAGCCTGG - Intronic
1070365177 10:75729861-75729883 GATCATAGCTCACTACAGCCTGG + Intronic
1070915243 10:80149915-80149937 GATTATGGCTCACTACAGCCTGG + Intergenic
1071590957 10:86872818-86872840 GATCACAGTGCATTGTAGCCTGG + Intronic
1071618764 10:87098839-87098861 GATCACAGTTTACCACAGCCTGG + Intronic
1071803223 10:89087915-89087937 GAGCCGAGTGCACTCCAGCCTGG - Intergenic
1072124652 10:92434714-92434736 CATCATAGCTCACTGCAGCCTGG - Intergenic
1072131817 10:92501316-92501338 GACACTAGTGCACTCCAGCCCGG + Intronic
1072134300 10:92529031-92529053 CACCATACTGCACTCCAGCCTGG + Intronic
1072198620 10:93138834-93138856 TATCATAGCTCACTGCAGCCTGG + Intergenic
1072463608 10:95642547-95642569 GATCATGGCTCACTGCAGCCTGG - Intronic
1072517236 10:96197368-96197390 AATCACAGTCCACTACAGCCTGG + Intronic
1072729058 10:97832558-97832580 CATCATAGCTCACTACACCCTGG - Intergenic
1072759032 10:98040697-98040719 GATCATGGCTCACCACAGCCTGG - Intergenic
1073039447 10:100592271-100592293 GATCATGGCTCACTGCAGCCTGG - Intergenic
1073243371 10:102072725-102072747 GATCACAGCTCACTGCAGCCTGG - Intergenic
1073361376 10:102902134-102902156 AATCATAGCTCACTGCAGCCTGG - Intergenic
1073373294 10:103010301-103010323 AATCATGGCGCACTACAGCCTGG + Intronic
1073400647 10:103254440-103254462 GATCATGGCTCACTATAGCCTGG + Intergenic
1073548395 10:104373609-104373631 GCACATACTGCACTCCAGCCTGG + Intronic
1073692635 10:105827547-105827569 GATCCTAGCTCACTGCAGCCTGG + Intergenic
1073800030 10:107031667-107031689 AATCATAGTGCACTACAGGCTGG + Intronic
1074127475 10:110540710-110540732 GATCATGGCTCACTGCAGCCTGG - Intergenic
1074488587 10:113915702-113915724 GATCATAGCTCACTGCAGCCTGG + Exonic
1074491066 10:113940121-113940143 CATGACACTGCACTACAGCCTGG + Intergenic
1074796416 10:116950228-116950250 GATCATAGCTCATTGCAGCCTGG + Intronic
1074849756 10:117430299-117430321 GATCACAGCTCACTGCAGCCTGG + Intergenic
1075039341 10:119095459-119095481 GATCATAGCTCACCACAACCTGG + Intergenic
1075152724 10:119948931-119948953 GATCACATGGCACTCCAGCCTGG + Intergenic
1075283996 10:121167077-121167099 GATCGCACTGCACTCCAGCCTGG + Intergenic
1075347416 10:121693676-121693698 GATCATAGCTCACTGCAGCCCGG - Intergenic
1075641133 10:124065314-124065336 GATCATGGCTCACTGCAGCCTGG - Intronic
1075692772 10:124410730-124410752 GATCATGGCTCACTGCAGCCTGG - Intronic
1075696684 10:124441260-124441282 GATCATGGCTCCCTACAGCCTGG + Intergenic
1077113927 11:874518-874540 GATCATAGCGCACTGCAGCCTGG + Intronic
1077121804 11:912269-912291 GATCACACTGCACTCCAGCCTGG + Intronic
1077627880 11:3789579-3789601 GATCATGGCTCACTGCAGCCTGG + Intronic
1078023907 11:7676586-7676608 GATCATTGCACAGTACAGCCTGG + Intronic
1078198613 11:9158502-9158524 CATGCTAGTGCACTCCAGCCTGG + Intronic
1078254272 11:9644170-9644192 GATCATAGCCCACTGTAGCCTGG + Intergenic
1078311241 11:10245343-10245365 GGTCATTGTGCACTATAGTCTGG - Intronic
1078398726 11:11004506-11004528 GATCATGGCTCGCTACAGCCTGG - Intergenic
1078780832 11:14437967-14437989 GATCATAGCTCACTGCAGCCTGG + Intergenic
1079043032 11:17076611-17076633 CATCATAGCTCACTGCAGCCTGG + Intronic
1079064757 11:17279853-17279875 GATCATGGCTCACTGCAGCCTGG + Intronic
1079202931 11:18390942-18390964 CATCACAGTTCACTGCAGCCTGG + Intergenic
1079439767 11:20499559-20499581 AATCATAGCTCACCACAGCCTGG - Intronic
1079956724 11:26875459-26875481 CATGATAGTGCACTCCAGCCTGG + Intergenic
1080141865 11:28931439-28931461 AATCATAGCTCACTGCAGCCTGG + Intergenic
1080171525 11:29308621-29308643 TATCATAGTTCACTGCAGCTAGG - Intergenic
1080272036 11:30460555-30460577 TATCATAGTTCACTGCAGCCTGG - Intronic
1080567155 11:33521103-33521125 GATCATAGTTCACTGCAGCCTGG - Intergenic
1080937447 11:36879496-36879518 CATGACACTGCACTACAGCCTGG - Intergenic
1081251296 11:40837782-40837804 GATCATGGCTCACTGCAGCCTGG - Intronic
1081304575 11:41495860-41495882 CATGCTAGTGCACTCCAGCCTGG + Intergenic
1081412617 11:42777606-42777628 AATCATAGCTCACTGCAGCCTGG + Intergenic
1081495725 11:43608294-43608316 GATCACAGCTCACTGCAGCCTGG - Intronic
1081568316 11:44274094-44274116 CATCTTATTGCACTCCAGCCTGG + Intronic
1081861682 11:46336620-46336642 CATGATAGTGCACTCCAGCCTGG - Intronic
1081900638 11:46624953-46624975 GATCATGGCTCACTGCAGCCTGG - Intronic
1081913695 11:46717863-46717885 AATCATAGCTCACTGCAGCCTGG + Intergenic
1081925347 11:46822702-46822724 GATCGCACTGCACTCCAGCCTGG + Intronic
1081959712 11:47126565-47126587 GATCATAGCTCGCTGCAGCCTGG - Intronic
1082013055 11:47463657-47463679 GATCACAGCTCACTGCAGCCTGG + Intergenic
1082023833 11:47556813-47556835 GATCATAGCTCACTGCAACCTGG - Intronic
1082833580 11:57637334-57637356 GATCATAGCTCACTGCAACCTGG + Intergenic
1082853302 11:57784341-57784363 GATCACAGCTCACTACAGCATGG - Intronic
1083132693 11:60640674-60640696 GATCATGGCTCACTGCAGCCTGG + Intergenic
1083186097 11:61018750-61018772 GATCATAGCTCACTGCAGCCTGG - Intronic
1083243686 11:61409099-61409121 CATGACAGTGCACTCCAGCCTGG + Intronic
1083340678 11:61956589-61956611 GATCTTAGCGCACTGCAGCCTGG - Intronic
1083401199 11:62424663-62424685 GATCATAGCTCACTGCAGCCTGG - Intergenic
1083412917 11:62506141-62506163 GATCATGGCTCACCACAGCCTGG - Intronic
1083577162 11:63800551-63800573 GATCACAGATCACTGCAGCCTGG - Intergenic
1083808749 11:65090459-65090481 GATCATAGTTCACTGCAGCCTGG - Intronic
1083817323 11:65142311-65142333 GATCATGGCTCACTGCAGCCTGG + Intergenic
1083884851 11:65567889-65567911 GATCATGGCCCACTGCAGCCTGG + Intergenic
1084091919 11:66884366-66884388 GGTCCCAGTGCACTCCAGCCTGG + Intronic
1084501036 11:69535577-69535599 GATCATAGTTCACTACAGCCTGG + Intergenic
1084623961 11:70293981-70294003 GATCTCACTGCACTCCAGCCTGG - Intronic
1084913434 11:72409538-72409560 TATGCTACTGCACTACAGCCTGG + Intronic
1084975613 11:72796019-72796041 GACCATTGTTCACTGCAGCCTGG + Intergenic
1085094786 11:73751211-73751233 GATTATAGCGTACTACAGCCCGG - Intronic
1085424123 11:76387855-76387877 GATCATGGCTCACTGCAGCCTGG - Intronic
1085759518 11:79229890-79229912 GATCACAGCTCACTGCAGCCTGG + Intronic
1086053407 11:82619994-82620016 GATCTCAGCTCACTACAGCCTGG - Intergenic
1086867875 11:92002012-92002034 GATCATAGTTCACTGCAGCCTGG - Intergenic
1087038485 11:93776267-93776289 GATCAGAGCTCACTGCAGCCTGG - Intronic
1087043676 11:93826172-93826194 GATCATAGCTCACTGCAGCCTGG - Intronic
1087533093 11:99408282-99408304 GATCATAGCTCACTGCAGCCTGG + Intronic
1087986708 11:104691194-104691216 GATCACACTGCACTCTAGCCTGG + Intergenic
1088260832 11:107942458-107942480 GATCATAGCTCACTGCAGCCTGG + Intronic
1088328409 11:108625702-108625724 GATCATAACTCACTGCAGCCTGG - Intergenic
1088637012 11:111831452-111831474 GATGACACTGCACTCCAGCCTGG + Intronic
1089144369 11:116313662-116313684 GATCATAGCTTACTGCAGCCTGG - Intergenic
1089195403 11:116691549-116691571 GATTATAGCACACTACAACCTGG - Intergenic
1089475235 11:118754339-118754361 AATCATAGCTCACTGCAGCCTGG - Intronic
1089715553 11:120355639-120355661 AATCATAGCTCACTGCAGCCTGG - Intronic
1089749701 11:120642263-120642285 GATCATGGCTCACTGCAGCCTGG - Intronic
1090017243 11:123097229-123097251 GATCATAGCTCACTGCAGCCTGG + Intronic
1090094950 11:123733621-123733643 AATCATAGCTCACTACAGCCTGG + Intronic
1090127409 11:124101723-124101745 AATCATGGTTCACTATAGCCTGG - Intergenic
1090542683 11:127726179-127726201 GATCATAGCTCACTGCAGCCTGG - Intergenic
1090694273 11:129221744-129221766 GATCATAGCCCACAGCAGCCTGG - Intronic
1090701519 11:129300099-129300121 CATGATCGTGCACTCCAGCCTGG + Intergenic
1090821830 11:130349544-130349566 GATCATAGCTCACTGCAGCCTGG + Intergenic
1091419519 12:324229-324251 TATCATAGCTTACTACAGCCTGG - Intronic
1091542359 12:1473562-1473584 GATCACAGCTCACTGCAGCCTGG - Intronic
1091571211 12:1688261-1688283 CATCATAGCTCACTGCAGCCTGG + Intergenic
1091721685 12:2818595-2818617 GATCATAGCTCACTACAGCCTGG - Intronic
1091739636 12:2951594-2951616 GATCATGGTTCACTGCAGCCTGG - Intergenic
1092135092 12:6141739-6141761 AATCATAGCTCACTGCAGCCTGG - Intergenic
1092232139 12:6782039-6782061 AATCATGGCTCACTACAGCCTGG - Intergenic
1092250504 12:6892638-6892660 GATCACAGCTCACTGCAGCCTGG - Intronic
1092684404 12:11026099-11026121 GATCATAGTCCACTGCAGCCTGG + Intronic
1092692431 12:11128986-11129008 AATCATAGCCCACTGCAGCCTGG + Intronic
1092798577 12:12139674-12139696 GTTCACACTGCACTGCAGCCTGG + Intronic
1092809200 12:12256443-12256465 GATCATTGCTCACTGCAGCCTGG - Intronic
1092832761 12:12461232-12461254 GATCACAGCTCACTGCAGCCTGG + Intronic
1093145286 12:15557979-15558001 GATCATCCTGCACTCCAGCCCGG - Intronic
1093556094 12:20475684-20475706 GATGCCAGTGCACTTCAGCCTGG + Intronic
1093683635 12:22031060-22031082 CATGCTAGTGCACTCCAGCCTGG + Intergenic
1093882628 12:24422943-24422965 CATCATAGCTCACTACAGCCTGG - Intergenic
1093914819 12:24789562-24789584 TATCATATCACACTACAGCCTGG + Intergenic
1093930723 12:24952560-24952582 GATCACAGCTCACTGCAGCCTGG - Intergenic
1094152994 12:27306785-27306807 GATCCCATTGCACTCCAGCCTGG - Intronic
1094162953 12:27411191-27411213 GATCATGGCTCACTGCAGCCTGG + Intronic
1094202683 12:27809564-27809586 GATCATGGCTCACTGCAGCCTGG + Intergenic
1094500115 12:31013521-31013543 GATCATGGCTCACTGCAGCCTGG - Intergenic
1094529882 12:31264165-31264187 CACCCTAGTGCACTCCAGCCTGG + Intergenic
1095818863 12:46455062-46455084 GATGATAGTGCACTACAACTTGG + Intergenic
1096303950 12:50457975-50457997 CATGTTACTGCACTACAGCCTGG - Intronic
1096401553 12:51311443-51311465 GATCATAGCTCACTGCAGCCTGG + Intronic
1096690493 12:53318070-53318092 GGTGATATTGCACTCCAGCCTGG - Intronic
1096758767 12:53822354-53822376 GATCATAGCTCACTGCAACCTGG + Intergenic
1096831026 12:54314526-54314548 AACGACAGTGCACTACAGCCTGG - Intronic
1096929475 12:55190709-55190731 GACCATAGCGCACTGCAACCTGG + Intergenic
1097105576 12:56621752-56621774 GATCATAGCTCACTGCAGCCTGG + Intronic
1097795816 12:63860899-63860921 AATCATTGTGCATTATAGCCTGG + Intronic
1097994066 12:65868432-65868454 GATCGTAGTGGACTGCATCCGGG - Intronic
1098013991 12:66084999-66085021 GATCATAGCTCACTACAACCTGG - Intergenic
1098102779 12:67036372-67036394 GATCTCATTGCACTCCAGCCTGG - Intergenic
1098297702 12:69020999-69021021 GATCACACTGCATTCCAGCCGGG + Intergenic
1098334564 12:69389555-69389577 GACGCTAGTGCACTCCAGCCTGG - Intronic
1098526846 12:71496322-71496344 GATCACACTGCACTCCAGTCTGG + Intronic
1098730208 12:74025881-74025903 GGTGACACTGCACTACAGCCTGG + Intergenic
1098769547 12:74536203-74536225 CATCATAGTTCACTGCAGCATGG - Intergenic
1098892494 12:76023638-76023660 GATCATAGCTCACTGCAGCCTGG - Intergenic
1098900602 12:76108550-76108572 AATCATAGCTCACTGCAGCCGGG + Intergenic
1098901642 12:76117352-76117374 GATCATAGTGCACTGTAACCTGG - Intergenic
1099125886 12:78757501-78757523 GATCATAGCTCACTGCAGCCTGG - Intergenic
1099174145 12:79401326-79401348 AATCATAGTGCACTGCAGCCTGG - Intronic
1099417913 12:82416485-82416507 CATGATACTGCACTCCAGCCTGG - Intronic
1099662732 12:85585865-85585887 AATCATAGCTCACTACAACCTGG - Intergenic
1100474981 12:94926998-94927020 GATCCCACTGCACTCCAGCCTGG - Intronic
1100534087 12:95490165-95490187 GATCATAGCCCACTGTAGCCTGG + Intronic
1100595557 12:96068845-96068867 GATCATAGCTCACTGCAACCTGG + Intergenic
1100659004 12:96677066-96677088 GATCATAGCTCACTGTAGCCTGG + Intronic
1100749989 12:97687837-97687859 CATGCTACTGCACTACAGCCTGG + Intergenic
1100846547 12:98664578-98664600 GATCTTACTGCACTCCAGCCTGG - Intronic
1100851701 12:98718866-98718888 GATCATAGCTCACTCCAGCCTGG - Intronic
1100988656 12:100229029-100229051 GATCCTAGCTCACTGCAGCCTGG + Intronic
1101034082 12:100687714-100687736 GATCTTAGTGCACTATAGCATGG - Intergenic
1101035508 12:100702154-100702176 AATCACATTGCACTCCAGCCTGG - Intergenic
1101108652 12:101464050-101464072 GATCATAGCTCACTGCAGACTGG + Intergenic
1101510795 12:105390543-105390565 GATCATAGCTCACTGCAGCCTGG - Intronic
1101745850 12:107540924-107540946 GATCATAGCTCACTGCAGCCTGG - Intronic
1101791403 12:107930986-107931008 GATCATAGCTTACTGCAGCCTGG + Intergenic
1101932459 12:109025735-109025757 GATCACAGCTCACTGCAGCCTGG + Intronic
1101953273 12:109192725-109192747 GATCACAGCTCACTGCAGCCTGG + Intronic
1101988751 12:109467576-109467598 GGCCCTAGTGCACTTCAGCCTGG + Intronic
1102160300 12:110763413-110763435 CATCATAGTTCACTGCAGCCTGG - Intergenic
1102349016 12:112178754-112178776 GATCACAGCTCACTGCAGCCGGG - Intronic
1102397754 12:112601873-112601895 GATCACAGCTCACTGCAGCCTGG - Intronic
1102502854 12:113364532-113364554 GATCATAGCTCACTGCAGCCTGG + Intronic
1102596541 12:113997061-113997083 GATCATAGCTCACTGCAGCCTGG - Intergenic
1102689605 12:114750131-114750153 GATCACGGCTCACTACAGCCTGG - Intergenic
1102902380 12:116648352-116648374 AATCATAGCTCACTGCAGCCTGG - Intergenic
1102907434 12:116687651-116687673 GATCACAGCTCACTGCAGCCTGG - Intergenic
1103086847 12:118068092-118068114 GATCATAGCTCACTGCAGCCTGG + Intronic
1103090408 12:118094172-118094194 AATTATGGTGCACTGCAGCCTGG + Intronic
1103304718 12:119954958-119954980 CATGATGGTGCACTACAGCCTGG + Intergenic
1103383827 12:120515987-120516009 AATCATAGCTCACTGCAGCCTGG + Intronic
1103511301 12:121476388-121476410 GATCATAGCTCACTGCAGCCTGG - Intronic
1103576978 12:121885243-121885265 GGTGCTACTGCACTACAGCCTGG - Intergenic
1103650250 12:122426467-122426489 AATCATAGCTCACTACAACCTGG + Intergenic
1103664805 12:122554977-122554999 AATCATAGCTCACTGCAGCCTGG - Intronic
1103787134 12:123441080-123441102 GATCACAGGTCACTGCAGCCTGG - Intergenic
1103856723 12:123975488-123975510 GATTCTAGTTCACTGCAGCCTGG + Intronic
1104154329 12:126116709-126116731 GATCTTGGTTCACTGCAGCCTGG + Intergenic
1104591817 12:130090018-130090040 GATCATAGCTGACTGCAGCCTGG - Intergenic
1104868954 12:131980587-131980609 GATGCCAGTGCACTCCAGCCCGG - Intronic
1105380779 13:19885206-19885228 AATCATGGCTCACTACAGCCTGG - Intergenic
1105445855 13:20456548-20456570 GATCATAGCTCACTGCAGCCTGG - Intronic
1105518267 13:21109806-21109828 GATCATAGCTGACTGCAGCCTGG + Intergenic
1105529657 13:21207926-21207948 AATCATCATGCACTACAGCCTGG - Intergenic
1105599860 13:21876982-21877004 AATCATAGCTCACTGCAGCCTGG + Intergenic
1105794563 13:23838207-23838229 GATCGCAGTTCACTGCAGCCTGG + Intronic
1105802930 13:23925441-23925463 AATCACAGCTCACTACAGCCTGG + Intergenic
1105906340 13:24813694-24813716 GATCATAGCTTACTGCAGCCTGG + Intronic
1105942353 13:25159944-25159966 GATCATGGCTCACTGCAGCCTGG - Intergenic
1106014226 13:25852858-25852880 CATGCTATTGCACTACAGCCTGG + Intronic
1106029165 13:25984169-25984191 GATCACAGCTCACTGCAGCCTGG - Intronic
1106071847 13:26419938-26419960 GATCATAGCCCACTGCAACCTGG + Intergenic
1106161448 13:27204578-27204600 GATCACAGCTCACTGCAGCCTGG + Intergenic
1106289397 13:28346642-28346664 AATCATAGCTCACTACAGCATGG - Intronic
1106515228 13:30447420-30447442 AGTCATTGTGCACTACATCCTGG + Intergenic
1106604006 13:31210808-31210830 GATCATAGTTTACTGCAGCCTGG + Intronic
1106736874 13:32597097-32597119 CATCATAGCTCACTGCAGCCTGG + Intronic
1106862057 13:33920492-33920514 GACCATGGTTCACTGCAGCCTGG + Intronic
1107304177 13:39000407-39000429 GATCACAGCTCACTGCAGCCTGG - Intergenic
1107558954 13:41543680-41543702 AAACATAGTGCACTACAACCTGG + Intergenic
1107604400 13:42043417-42043439 GATCGTAGCTCACTGCAGCCAGG + Intronic
1107697199 13:43011914-43011936 GATCATAGCTCACTATAGCCTGG + Intergenic
1107872014 13:44755664-44755686 GATCAGAGTTCACTGCAGTCTGG + Intergenic
1107909808 13:45095218-45095240 GATCATAGCTCACTACAGTCTGG - Intergenic
1107915980 13:45151423-45151445 GTTCATAGTGAGCTACAGCCTGG + Intronic
1108107772 13:47031079-47031101 GATCATAGCTCACTGCAGCCTGG + Intergenic
1108196852 13:48003479-48003501 GATCACGGTTCACTGCAGCCTGG - Intergenic
1108494484 13:51010537-51010559 GATCACACTGCACTCCAGCCTGG - Intergenic
1108523420 13:51264556-51264578 GATCATAGAGCACTGCGGCCTGG - Intronic
1108859807 13:54842771-54842793 AATCATAGCTCACTGCAGCCTGG + Intergenic
1109060705 13:57615815-57615837 GATCATAGCTCACTGCAGCCTGG - Intergenic
1109586836 13:64415874-64415896 AATCATAGCTCACTGCAGCCAGG + Intergenic
1109720030 13:66264154-66264176 AATCATAGCTCACTTCAGCCTGG + Intergenic
1109751460 13:66698642-66698664 GATCATAGCTCACTACAGCCTGG + Intronic
1109756757 13:66771146-66771168 AATCATGATGTACTACAGCCTGG + Intronic
1110064123 13:71080958-71080980 GATCATAGCTCACGGCAGCCTGG + Intergenic
1110216617 13:73031195-73031217 CATGCCAGTGCACTACAGCCTGG - Intergenic
1110217667 13:73041523-73041545 AATCATAGCTCACTGCAGCCTGG - Intergenic
1110409969 13:75194259-75194281 AATCATAGCTCACTGCAGCCTGG + Intergenic
1110692726 13:78450664-78450686 GATCATAGCTCACTGTAGCCTGG - Intergenic
1110903077 13:80848704-80848726 GACCCTACTGCACTCCAGCCTGG - Intergenic
1110924597 13:81135075-81135097 GATCATAGCTCACTGCAGCCTGG - Intergenic
1111368221 13:87279053-87279075 AATCATAGCACAATACAGCCTGG + Intergenic
1111702426 13:91707553-91707575 GATCATGGCTCACTGCAGCCTGG - Intronic
1111849954 13:93560452-93560474 GATCATGGGTCACTGCAGCCTGG - Intronic
1112131588 13:96530566-96530588 AATCATAGCTCACTACAGCCTGG + Intronic
1112283248 13:98081110-98081132 GATCACAGCTCACTGCAGCCTGG - Intergenic
1112540632 13:100308366-100308388 CATGATACTGCACTCCAGCCTGG - Intronic
1113515807 13:110897190-110897212 AATCATAGTTCACCACACCCTGG + Intronic
1113732945 13:112655643-112655665 GATCGCATTGCACTCCAGCCTGG - Intronic
1113948658 13:114059109-114059131 GATCACAGCTCACTGCAGCCTGG - Intronic
1114518405 14:23316980-23317002 GATCATAGCTCACTGCAGCCTGG + Intronic
1114740168 14:25088669-25088691 GATCATAGCTCACTGCAGCTTGG + Intergenic
1115118762 14:29914684-29914706 GATCACACTGCACTCCAGTCTGG + Intronic
1115154788 14:30325751-30325773 CATGATCGTGCACTTCAGCCGGG + Intergenic
1115218720 14:31037884-31037906 GATCATAGCTCACTACACCCTGG - Intronic
1115222612 14:31072434-31072456 CATCATAGCTCACTGCAGCCTGG + Intronic
1115223795 14:31083568-31083590 GATCATGGCTCACTACACCCTGG + Intronic
1115243408 14:31271267-31271289 CATACCAGTGCACTACAGCCTGG + Intergenic
1115247477 14:31310936-31310958 AATCATAGTGCACTACAGCTGGG - Intronic
1115267031 14:31511399-31511421 GATCACAGTGCACTGCAACCTGG + Intronic
1115503694 14:34073361-34073383 CATCATAGCTCACTGCAGCCTGG + Intronic
1115635990 14:35291055-35291077 GATCATAGCTCACTGCAACCTGG + Intronic
1115647379 14:35378446-35378468 GATCATAGCTCACCGCAGCCTGG - Intergenic
1115647487 14:35379600-35379622 GATCATAGCTCACTGTAGCCTGG + Intergenic
1115671023 14:35611667-35611689 GATCAGAGCTCACTGCAGCCTGG - Intronic
1115710952 14:36050058-36050080 AATCATAGCTCACTGCAGCCTGG - Intergenic
1116051707 14:39811687-39811709 GATCACACTGCACTCCAGCCTGG + Intergenic
1116442508 14:44969196-44969218 GATCGCACTGCACTCCAGCCTGG - Intronic
1116798239 14:49414480-49414502 GATCATAGTTCACTGTAGCCTGG - Intergenic
1116903293 14:50381836-50381858 GATCATAGCTCACTGCAGCCTGG + Intronic
1116904955 14:50395599-50395621 GATCATAGCTCACAGCAGCCTGG - Intronic
1116927896 14:50659798-50659820 CATGCTACTGCACTACAGCCCGG + Intronic
1117054813 14:51901230-51901252 GATCACACTGCACTCCAGCCTGG - Intronic
1117124431 14:52606502-52606524 GATCTCAGCTCACTACAGCCTGG + Intronic
1117127836 14:52650151-52650173 AATCATAGCTCACTGCAGCCTGG - Intronic
1117430529 14:55655052-55655074 GATCATGGCTCACTGCAGCCAGG + Intronic
1117675868 14:58154228-58154250 AATCACAGTTCACTGCAGCCTGG + Intronic
1117731799 14:58729979-58730001 GGTGATATTGCACTCCAGCCTGG + Intergenic
1117862516 14:60107333-60107355 GATCACAGTACACTCCAGCTTGG + Intronic
1117869554 14:60186211-60186233 CATCATAATTCACTGCAGCCTGG + Intergenic
1118223538 14:63877929-63877951 GATACTACTGCACTCCAGCCTGG - Intronic
1118233583 14:63977692-63977714 GATCATAGCTCACTGCAGCCTGG - Intronic
1118278373 14:64406556-64406578 GATCACAGTTCATTGCAGCCTGG + Intronic
1118361231 14:65059086-65059108 GATCATAGCTCACTGCAGCCTGG + Intronic
1118381769 14:65223342-65223364 GACAACACTGCACTACAGCCTGG + Intergenic
1118384095 14:65240863-65240885 GATCATGGCTCACTGCAGCCTGG + Intergenic
1118611749 14:67546817-67546839 GATCACACTACACTCCAGCCTGG + Intronic
1118833491 14:69457819-69457841 AATCATAACACACTACAGCCTGG - Intronic
1118844158 14:69533964-69533986 TATACTAGTGCACTCCAGCCTGG - Intergenic
1119277771 14:73374765-73374787 GATCATGTTGGACTCCAGCCTGG - Intronic
1119357827 14:74021543-74021565 GGTGCTACTGCACTACAGCCTGG + Intronic
1119363692 14:74073148-74073170 GATCACACTACACTCCAGCCTGG - Intronic
1119577420 14:75738868-75738890 GATCACAGCTCACTACAGCCTGG + Intronic
1120154042 14:81071693-81071715 GATCATAGCTCACTGCAGCCTGG - Intronic
1120177126 14:81306450-81306472 GATCATGGCATACTACAGCCTGG + Intronic
1120202960 14:81557849-81557871 GATCACAGCTCACTGCAGCCTGG + Intergenic
1120816141 14:88860848-88860870 GATCGCACTGCACTCCAGCCTGG - Intronic
1120856503 14:89217198-89217220 GATCACAGCTCACTGCAGCCTGG + Intronic
1121136701 14:91505404-91505426 GATGCTACTGCACTCCAGCCAGG + Intronic
1121372067 14:93368514-93368536 CATCCTACTGCACTCCAGCCTGG - Intronic
1121619971 14:95339506-95339528 CACTATACTGCACTACAGCCTGG + Intergenic
1121835635 14:97089763-97089785 GATCGCACTGCACTCCAGCCTGG - Intergenic
1121874234 14:97436507-97436529 AATCATAGTGTACTGCAGCCTGG - Intergenic
1121988694 14:98533319-98533341 GATCATGGCTCACTGCAGCCTGG + Intergenic
1122431519 14:101651184-101651206 GATCATAGCACACTATAGCCTGG - Intergenic
1122496784 14:102162658-102162680 GATCACACTGCACTCCAGCCTGG - Intronic
1122553610 14:102564122-102564144 GATACCAGTGCACTCCAGCCTGG - Intergenic
1122590703 14:102848361-102848383 GATCCTAGCTCACTGCAGCCTGG - Intronic
1122655113 14:103253465-103253487 GATCATAGCTCACTGCAGCCTGG + Intergenic
1122671139 14:103373323-103373345 GATGCTACTGCACTCCAGCCTGG - Intergenic
1122678411 14:103436676-103436698 GATCATAGCTCACTGTAGCCTGG + Intronic
1122683775 14:103487999-103488021 GATCACACTGCACTCCAGCCTGG + Intronic
1122727445 14:103767246-103767268 AATCATAGTTCACTGCAGCTTGG - Intronic
1122736298 14:103844680-103844702 GATCATGTTGCACTCCAGCCTGG + Intronic
1122755085 14:103972086-103972108 AATCACAGTTCACTGCAGCCTGG - Intronic
1122962257 14:105100411-105100433 AATCATAGCTCACTACAGCCTGG + Intergenic
1123001256 14:105295716-105295738 GATCACAGGTCACTGCAGCCTGG - Intronic
1123022014 14:105403486-105403508 AATCACAGCTCACTACAGCCTGG + Intronic
1123413080 15:20075239-20075261 GATCATAGTTTATTGCAGCCTGG + Intergenic
1123442005 15:20299139-20299161 GATCACAGCTCACTGCAGCCTGG + Intergenic
1123522422 15:21082352-21082374 GATCATAGTTTATTGCAGCCTGG + Intergenic
1123900603 15:24872826-24872848 GATCACACTGCACTCCAGCCTGG + Intronic
1123975570 15:25551206-25551228 CATCATAGCTCACTGCAGCCTGG - Intergenic
1123997924 15:25731919-25731941 GATCATAGCTCACTGCAGCCTGG + Intronic
1124032914 15:26027658-26027680 GTTCATAGTGCGCTGCAGGCTGG + Intergenic
1124339798 15:28883447-28883469 GATCATAGTTCACTGCAGCCTGG + Intergenic
1124621305 15:31275647-31275669 GAGCATTGTGCACAATAGCCTGG - Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1124984314 15:34591432-34591454 GATGATAGTGTACCACACCCGGG - Intergenic
1125004539 15:34802064-34802086 GATCACAGCTCACTGCAGCCTGG - Intergenic
1125049626 15:35282235-35282257 AATCATAGCTCACTACAGCCTGG + Intronic
1125082196 15:35687939-35687961 GATGCCAGTGCACTCCAGCCTGG + Intergenic
1125229826 15:37441027-37441049 AATCATGGTTCACTGCAGCCTGG + Intergenic
1125331693 15:38588937-38588959 AATCAAAGTGCAATACTGCCTGG - Intergenic
1125557685 15:40599874-40599896 AATCATAGTACACTGCAGCCTGG + Intronic
1125582929 15:40799913-40799935 AATCATAGCGCACTGTAGCCTGG + Intronic
1125638879 15:41212973-41212995 AATCAGAGTTCACTGCAGCCTGG - Intronic
1125671341 15:41475153-41475175 CATCATAGTGCACTGCAGCTTGG + Intronic
1126010294 15:44296114-44296136 GATCATAGCACACCACAGCCAGG + Intronic
1126081633 15:44968993-44969015 GATCATAGCTCACTGCAACCTGG + Intronic
1126179389 15:45769839-45769861 GATCGCACTGCACTCCAGCCTGG - Intergenic
1126442756 15:48709272-48709294 GGTCATAGCTCACTGCAGCCTGG + Intergenic
1126830307 15:52596046-52596068 GATCATACCTCACTGCAGCCTGG - Intronic
1127084526 15:55412699-55412721 GATAATAGTGCACTGCAACCTGG - Intronic
1127227372 15:56946842-56946864 GATCATGGTACACTCCAGCATGG - Intronic
1127242911 15:57137983-57138005 CACCATTGTGCACTCCAGCCTGG + Intronic
1127395428 15:58540845-58540867 GATCACACTGCCCTCCAGCCTGG - Intronic
1127422275 15:58818322-58818344 GATCATAGCTCACTGCAACCTGG + Intronic
1127470791 15:59288239-59288261 GATCACAGCTCACTGCAGCCTGG + Intronic
1128037379 15:64538898-64538920 GATCATAGTTCACTGCAGCCTGG + Intronic
1128423329 15:67515668-67515690 CATCATAGCTCACTGCAGCCTGG - Intergenic
1128473505 15:67976310-67976332 GATCATCACGCTCTACAGCCTGG - Intergenic
1128587507 15:68862888-68862910 CATGATACTGCACTCCAGCCTGG + Intronic
1128828821 15:70747411-70747433 GATGACAGTGTACTCCAGCCTGG - Intronic
1129280151 15:74478805-74478827 CATGATACTGCACTCCAGCCTGG + Intergenic
1129436009 15:75541011-75541033 GATCACAGCTCACTGCAGCCTGG - Intronic
1129508488 15:76102793-76102815 GATGCCAGTGCACTCCAGCCTGG + Intronic
1129666123 15:77580296-77580318 AATCATAGGTCACTGCAGCCTGG - Intergenic
1129804680 15:78445848-78445870 GATCATGGCTCACTGCAGCCTGG + Intronic
1129925585 15:79360891-79360913 CACAATAGTGCACTCCAGCCTGG - Intronic
1130019722 15:80218199-80218221 AATCATAGCTCACTGCAGCCTGG + Intergenic
1130327594 15:82893688-82893710 AATCATAGCTCACTGCAGCCTGG + Intronic
1130569469 15:85028278-85028300 GATTATAGCTCACTGCAGCCTGG + Intronic
1130744157 15:86632200-86632222 GATCATAACTCACTGCAGCCTGG - Intronic
1130771420 15:86927519-86927541 GATCATAGCTCACTGCAGCCTGG - Intronic
1131051416 15:89350617-89350639 GAGCACATTGCACTCCAGCCCGG - Intergenic
1131169436 15:90166723-90166745 GATCATAGCTCACTGCAGCCTGG - Intronic
1131182298 15:90249143-90249165 CATCATAGCTCACTGCAGCCTGG - Intergenic
1131195800 15:90353659-90353681 CATCATAGCTCACTGCAGCCTGG + Intronic
1131208752 15:90474854-90474876 GATCACATCGCACTACAACCTGG - Intronic
1131287827 15:91076650-91076672 TATAATACTGCACTCCAGCCTGG - Intergenic
1131405311 15:92159630-92159652 GATCATGGCTCACTGCAGCCTGG + Intronic
1131600335 15:93841157-93841179 CATCACACTGCACTCCAGCCTGG - Intergenic
1131740132 15:95380346-95380368 GATCATAGCTCACTATAGCCTGG - Intergenic
1131900940 15:97086968-97086990 GATCATGCCGCACTCCAGCCTGG + Intergenic
1132077730 15:98836451-98836473 GATCATAGTTCACTGCAGCCTGG - Intronic
1132123435 15:99197857-99197879 GATCATACTGCACTCCAGCCTGG + Intronic
1132179837 15:99743894-99743916 GATCATAGGTCCCTGCAGCCTGG - Intergenic
1132199068 15:99935639-99935661 GATCATGGATCACTGCAGCCTGG + Intergenic
1132479098 16:157474-157496 AATCATAGCTTACTACAGCCTGG - Intronic
1132905783 16:2282164-2282186 AATCATAGGTCACTGCAGCCCGG + Intronic
1132951986 16:2568096-2568118 GATCCCACTGCACTCCAGCCTGG + Intronic
1132962364 16:2632074-2632096 GATCCCACTGCACTCCAGCCTGG - Intergenic
1133000375 16:2848013-2848035 GATCATGGCTCACTGCAGCCTGG - Intergenic
1133037869 16:3044783-3044805 GATCATAGCTCACCGCAGCCTGG - Intergenic
1133252760 16:4494811-4494833 GATCATAGCTCACTGCAGCCTGG - Intronic
1133327545 16:4951073-4951095 GATCATTGCTCACTGCAGCCTGG + Intronic
1133735900 16:8615535-8615557 GATCACAGCGCACTGCAGCCTGG - Intergenic
1134082481 16:11334603-11334625 CAAGACAGTGCACTACAGCCTGG + Intronic
1134119552 16:11574105-11574127 GATCATAGCTCATTGCAGCCTGG + Intronic
1134140383 16:11713236-11713258 CATGATTGTGCACTCCAGCCTGG + Intronic
1134154871 16:11835062-11835084 GACACTAGTGCACTCCAGCCTGG + Exonic
1134169834 16:11959522-11959544 GATCACAGCTCACTGCAGCCTGG - Intronic
1134293299 16:12921698-12921720 GATCATAGCTCACTGCAGCCTGG - Intronic
1134622809 16:15702454-15702476 GATCATAGCTCACTGCAGCCTGG + Intronic
1134650682 16:15906247-15906269 GATCATAGCTCACTGCAGCCTGG - Intergenic
1134654066 16:15933626-15933648 GATAATTTTGCACTCCAGCCTGG - Intergenic
1134896172 16:17888784-17888806 CATCATAGCTCACTGCAGCCTGG - Intergenic
1135003417 16:18797336-18797358 GAGCGTACTGCACTCCAGCCTGG + Intronic
1135182013 16:20283264-20283286 GATCATAGCTCACTGCACCCTGG - Intergenic
1135253488 16:20921444-20921466 AATCATGCTGCACTCCAGCCTGG - Intronic
1135269940 16:21060566-21060588 CATGACAGTGCACTCCAGCCTGG - Intronic
1135392787 16:22107678-22107700 AATCATAGCTCACTGCAGCCTGG - Intronic
1135417722 16:22281303-22281325 AATCATAGCTCACTCCAGCCTGG + Intronic
1135602237 16:23793317-23793339 GATCACACTGCACTCCAGGCTGG - Intergenic
1135635536 16:24072331-24072353 GATCATAGCTCACTGCAGCCTGG + Intronic
1135731654 16:24899767-24899789 GATTATAGCTCACTGCAGCCTGG + Intronic
1135771827 16:25223641-25223663 GATCATAGCTCACTGCAGCCTGG - Intronic
1135809231 16:25572410-25572432 AATCATAGCTCACTGCAGCCTGG + Intergenic
1135824925 16:25718251-25718273 AAGCACAGTGCACTACAGCCAGG - Intronic
1135887159 16:26320638-26320660 GATCATAGCTCACTGCAGCCTGG - Intergenic
1136039651 16:27567896-27567918 GAACATAGCTCACTACAGCCTGG - Intronic
1136161057 16:28419048-28419070 CATCCTACTGCACTCCAGCCTGG - Intergenic
1136201906 16:28695943-28695965 CATCCTACTGCACTCCAGCCTGG + Intronic
1136218251 16:28810135-28810157 CATCCTACTGCACTCCAGCCTGG + Intergenic
1136449694 16:30346850-30346872 GATCATAGCTCACTGCAGGCTGG - Intergenic
1136467113 16:30451976-30451998 AATCACAGTTCACTGCAGCCTGG + Intergenic
1136486691 16:30577126-30577148 GATCAAAGCTCACTGCAGCCTGG + Intronic
1136523804 16:30814817-30814839 GATCATACTACACTGCAGCGTGG - Intergenic
1136539046 16:30918347-30918369 GATCATGGCTCACTGCAGCCTGG + Intergenic
1136542809 16:30937765-30937787 TATCATACTCCACAACAGCCAGG - Intronic
1136597161 16:31259460-31259482 GATCCTAGCTCACTGCAGCCTGG + Intergenic
1136717848 16:32299165-32299187 GATCATAGCTCACTGTAGCCTGG - Intergenic
1136719210 16:32306379-32306401 GATCACAGATCACTGCAGCCTGG - Intergenic
1136724231 16:32344739-32344761 GATCACAGCCCACTGCAGCCTGG - Intergenic
1136836223 16:33505435-33505457 GATCATAGCTCACTGTAGCCTGG - Intergenic
1136837581 16:33512643-33512665 GATCACAGATCACTGCAGCCTGG - Intergenic
1136842560 16:33550783-33550805 GATCACAGCTCACTGCAGCCTGG - Intergenic
1137004779 16:35264888-35264910 AATCATGGTGCGTTACAGCCTGG - Intergenic
1137020973 16:35427135-35427157 AATCATGGTGCATTACAGCCTGG - Intergenic
1137034193 16:35555043-35555065 AATCATGGTGCATTACAGCCTGG - Intergenic
1137287466 16:47028030-47028052 GATCATAGCTCGCTGCAGCCTGG + Intergenic
1137365683 16:47857628-47857650 GATCATAGCTCACTGCAACCTGG + Intergenic
1137441556 16:48502790-48502812 GATCATAGCTCACTGCAGCATGG - Intergenic
1137442160 16:48506898-48506920 GATCATAGCTCACTGCAGCCTGG + Intergenic
1137514312 16:49129861-49129883 GATCATAGCTTACTGCAGCCTGG + Intergenic
1137715814 16:50597744-50597766 GATCATCGTGCACTGCTGCGTGG + Intronic
1137738872 16:50745431-50745453 GATCATAGCTCTCTTCAGCCTGG + Intronic
1137886703 16:52112117-52112139 GATTATAGTTCACTACAGCTTGG + Intergenic
1137896836 16:52222023-52222045 AATCATAGTGCATTACAGCCTGG - Intergenic
1137978104 16:53047931-53047953 AATCATAGCTCACTACAGCCTGG - Intergenic
1138007606 16:53352749-53352771 GTTGATACTGCACTCCAGCCTGG + Intergenic
1138007690 16:53353594-53353616 GATCACACTACACTCCAGCCTGG - Intergenic
1138060576 16:53885812-53885834 GATCATGGCTCACTGCAGCCTGG + Intronic
1138090002 16:54166101-54166123 GATCATAGCTCACTACAGCCTGG - Intergenic
1138153153 16:54678090-54678112 TATGCTACTGCACTACAGCCTGG + Intergenic
1138408946 16:56822445-56822467 GATCATGGCTCACTGCAGCCTGG - Intronic
1139319076 16:66098380-66098402 CATCAGAGTCCACTAGAGCCTGG + Intergenic
1139488514 16:67272708-67272730 AATCATAGCTCACTGCAGCCTGG + Intergenic
1139628238 16:68209324-68209346 GATGCTACTGCACTCCAGCCTGG + Intronic
1139822981 16:69735441-69735463 GATCCTAGCTCACTGCAGCCTGG + Intergenic
1139832056 16:69807910-69807932 AATCATGCTGCACTCCAGCCTGG + Intronic
1139918644 16:70444406-70444428 AATCATGGTTCACTGCAGCCTGG - Intergenic
1140176202 16:72663116-72663138 GATCATTGGCCACTGCAGCCTGG + Intergenic
1140233589 16:73138751-73138773 GATCATGGCTCACTGCAGCCTGG + Intronic
1140390100 16:74579113-74579135 GATCATAGCTCACTACAGCCTGG - Intronic
1140578350 16:76199239-76199261 AATCATAGCTCACTGCAGCCTGG - Intergenic
1141078336 16:81029463-81029485 GATCATGGCTCACTGCAGCCTGG + Intronic
1141591800 16:85074019-85074041 GATCCCACTGCACTCCAGCCTGG - Intronic
1141777200 16:86132314-86132336 AATCATAGCTCACTGCAGCCTGG - Intergenic
1141892965 16:86939518-86939540 GATCATAGTGCCCTCCACCCTGG - Intergenic
1141986683 16:87584903-87584925 GATCACACTGCACTCCAGCCTGG + Intergenic
1203002201 16_KI270728v1_random:173026-173048 GATCACAGCCCACTGCAGCCTGG + Intergenic
1203007221 16_KI270728v1_random:211392-211414 GATCACAGATCACTGCAGCCTGG + Intergenic
1203008581 16_KI270728v1_random:218601-218623 GATCATAGCTCACTGTAGCCTGG + Intergenic
1203133804 16_KI270728v1_random:1709432-1709454 GATCACAGCCCACTGCAGCCTGG + Intergenic
1203146401 16_KI270728v1_random:1805727-1805749 GATCATAGCTCACTGTAGCCTGG - Intergenic
1203147763 16_KI270728v1_random:1812921-1812943 GATCACAGCTCACTGCAGCCTGG - Intergenic
1203152725 16_KI270728v1_random:1851080-1851102 GATCACAGCTCACTGCAGCCTGG - Intergenic
1142477272 17:196291-196313 GATCCTAGCTCACTACATCCTGG - Intergenic
1142513362 17:411466-411488 GATCATAGCTCACTGCAGCCTGG - Intronic
1142524659 17:531568-531590 GATCATAGCTCACTTCAGCCTGG + Intronic
1142852956 17:2713088-2713110 GATCATAGCTCACTGCAGCTTGG - Intergenic
1143050503 17:4121577-4121599 GATCCCACTGCACTCCAGCCTGG + Intronic
1143060899 17:4200103-4200125 GATGACACTGCACTTCAGCCTGG - Intronic
1143078952 17:4367207-4367229 GATCATAGCTCACTGCAGCTTGG + Intergenic
1143167642 17:4905516-4905538 GATCACACTACACTCCAGCCTGG + Intergenic
1143209015 17:5169505-5169527 GATCACAGCTCACTGCAGCCTGG + Intronic
1143429048 17:6866115-6866137 AATCACACTGCACTCCAGCCTGG - Intergenic
1143652785 17:8274367-8274389 CACGCTAGTGCACTACAGCCTGG - Intergenic
1144235692 17:13258227-13258249 AATCATAGCTCACTGCAGCCTGG + Intergenic
1144526134 17:15991843-15991865 AATCATAGCTCACTGCAGCCTGG + Intronic
1144544557 17:16180680-16180702 GATCATGGCTCACTGCAGCCTGG - Intronic
1144583787 17:16475615-16475637 GATCCTAGCTCACTGCAGCCTGG + Intronic
1145026213 17:19469746-19469768 GATGCCACTGCACTACAGCCTGG - Intergenic
1145069017 17:19787350-19787372 GACCATAGCTCACTGCAGCCTGG + Intronic
1146131608 17:30281731-30281753 AATCATAGCTCACTGCAGCCTGG + Intronic
1146139209 17:30350271-30350293 GATCATAGCTCAGTGCAGCCTGG + Intergenic
1146340736 17:32017724-32017746 TATCATAGCTCACTGCAGCCTGG - Intronic
1147151061 17:38514252-38514274 GATCACAGCTCACTGCAGCCTGG + Intergenic
1147151104 17:38514556-38514578 GATCGAAGTTCACTGCAGCCCGG + Intergenic
1147203307 17:38818543-38818565 GATCGTGCTGCACTCCAGCCTGG + Intronic
1147267143 17:39241535-39241557 AATCATAGCTCACTGCAGCCTGG + Intergenic
1147346767 17:39802753-39802775 GATCACAGCTCACTGCAGCCTGG - Intronic
1147401969 17:40185918-40185940 CACCTTACTGCACTACAGCCTGG + Intronic
1147411707 17:40257697-40257719 GATCATGCCGCACTCCAGCCTGG + Intronic
1147654999 17:42084262-42084284 GATAATAGCTCACTGCAGCCTGG - Intergenic
1147701639 17:42399779-42399801 GGTCATAGCTCACTGCAGCCTGG + Intergenic
1147920097 17:43911006-43911028 GATCATAGCTCACTGCAGGCTGG + Intergenic
1148055551 17:44792631-44792653 GATCATAGCTCACTGCAGCCTGG - Intergenic
1148147502 17:45375240-45375262 GATCACAGCTCACTGCAGCCTGG + Intergenic
1148374614 17:47131710-47131732 GGTGATACTGCACTCCAGCCTGG - Intronic
1148599436 17:48883008-48883030 AATCATAGCTCACTGCAGCCTGG - Intergenic
1148648427 17:49232340-49232362 GATCATGCTGCACTCCAGCCTGG + Intergenic
1148661520 17:49337268-49337290 GATCATAGCTTACTATAGCCTGG - Intronic
1148810328 17:50286234-50286256 GATTATAGCTCACTGCAGCCTGG + Intergenic
1148857187 17:50585209-50585231 GATCATGGCTCACTACAGCCTGG + Intronic
1148909287 17:50931877-50931899 GATCACAGCTCACTACAGCCTGG - Intergenic
1148918141 17:51002079-51002101 AATCATAGCTCACTGCAGCCTGG + Intronic
1149090496 17:52772399-52772421 GGTCACATTGCACTCCAGCCTGG + Intergenic
1149132349 17:53318277-53318299 GATCATAGTTCACTGTAACCTGG + Intergenic
1149274812 17:55021456-55021478 GATCATGGCTCACTGCAGCCTGG - Intronic
1149318563 17:55461534-55461556 GATCACAGCTCACTACAGCCTGG - Intergenic
1149428932 17:56581401-56581423 CATGATACTGCACTCCAGCCTGG + Intergenic
1149598469 17:57877839-57877861 AATCCCAGTGCACTCCAGCCTGG + Intronic
1149663681 17:58351184-58351206 GATCATAGCTCACTGCAGCGTGG - Intronic
1149788812 17:59459623-59459645 AATCATAGCTCACTACAGCCTGG + Intergenic
1149805194 17:59610612-59610634 GATCATGCTGTACTCCAGCCTGG - Intergenic
1149889357 17:60372784-60372806 GATCATAGCTCACTGCAGCCTGG - Intronic
1149921755 17:60666977-60666999 GATCATCGCACACTATAGCCTGG - Intergenic
1149991630 17:61386842-61386864 AATCATAGCCCACTGCAGCCTGG + Intronic
1150206106 17:63409235-63409257 GATCATAGCTCACCAAAGCCTGG + Intronic
1150435706 17:65152593-65152615 GATCATAGCTCACTGTAGCCTGG + Intronic
1150505983 17:65699691-65699713 GATCATAGCACCCTATAGCCTGG + Intronic
1150569157 17:66370614-66370636 GATCATAGGTCACTGCAACCTGG + Intronic
1150580770 17:66472025-66472047 CATCATAGATCACTGCAGCCTGG + Intronic
1150909749 17:69375654-69375676 GATCATGGCTCACTGCAGCCTGG + Intergenic
1151500472 17:74485021-74485043 GATCACAGCTCACTGCAGCCTGG + Intergenic
1151555583 17:74844995-74845017 GATCATGGCTCACTGCAGCCTGG + Intronic
1151617092 17:75220460-75220482 GGTGATTGTGCACTGCAGCCTGG - Intronic
1151713767 17:75821115-75821137 GATCCTAGCTCACTGCAGCCTGG + Intronic
1151881345 17:76896982-76897004 GATCATGGCTCACTGCAGCCTGG + Intronic
1151891475 17:76953214-76953236 GATCACAGCTCACTGCAGCCTGG - Intergenic
1152486479 17:80597571-80597593 GATCGCACTGCACTCCAGCCTGG - Intronic
1152575721 17:81140076-81140098 GATCACAGCTCACTGCAGCCTGG + Intronic
1152650962 17:81492621-81492643 GATCATAGCTCACTGCAGCCTGG - Intergenic
1153053780 18:925764-925786 CATGATACTGCACTCCAGCCTGG + Intergenic
1153264885 18:3260583-3260605 GATCATAATGCACTACAACCTGG - Intergenic
1153274202 18:3352089-3352111 GATCATAGCTCACTGCAACCTGG - Intergenic
1153294219 18:3530339-3530361 GATCATAGCTCACTGTAGCCTGG - Intronic
1153890185 18:9506595-9506617 GACCACAGTGCACTTCAGCCTGG - Intronic
1154066259 18:11110188-11110210 GATCATAGCTCACTGCATCCTGG + Intronic
1154126103 18:11693916-11693938 GATCATGGCTCACTGCAGCCTGG + Intronic
1154195162 18:12260238-12260260 GGCCACAGTGCACTCCAGCCTGG - Intronic
1154285625 18:13053753-13053775 GATCACAGCTCACTACAGCCTGG + Intronic
1154297446 18:13162961-13162983 GATCACAGCTCACTGCAGCCTGG + Intergenic
1154317071 18:13312674-13312696 GATCACAGCTCACTACAGTCTGG - Intronic
1154331754 18:13435510-13435532 GATCATAGCTCACTGCAGCCTGG + Intronic
1155208967 18:23584979-23585001 CATCATAGCTCACTGCAGCCTGG - Intronic
1155218838 18:23666455-23666477 GATCACAGCTCACTGCAGCCTGG + Intergenic
1155305973 18:24478736-24478758 AATCATAGCTCACTGCAGCCTGG + Exonic
1155307791 18:24496017-24496039 CATGCTACTGCACTACAGCCTGG - Intergenic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1155817464 18:30331780-30331802 GATCACAGCTCACTGCAGCCAGG + Intergenic
1156130348 18:33965425-33965447 GATCATAGCTCACAGCAGCCTGG - Intronic
1156325689 18:36072717-36072739 GATCACAGCTCACTGCAGCCTGG - Intergenic
1156582082 18:38389219-38389241 AATCATAGGTCACTACAGCCTGG - Intergenic
1157263339 18:46195332-46195354 GATCATAGCTTACTACAGCCTGG + Intronic
1157541338 18:48512345-48512367 GATCACAGCTCACTGCAGCCTGG - Intergenic
1157760593 18:50261436-50261458 GATCACACTGCACTCCAGCCTGG - Intronic
1157840108 18:50949397-50949419 GGTCATAGAGCACTGCAGCCTGG + Exonic
1158026114 18:52899213-52899235 GATCATAGCTTACTGCAGCCTGG + Intronic
1158113545 18:53969374-53969396 GATCACAGCTCACTGCAGCCTGG - Intergenic
1158218293 18:55123214-55123236 TATCACATTGCACTCCAGCCTGG - Intergenic
1158261809 18:55613982-55614004 GATCATAGCTCACTGCGGCCTGG + Intronic
1158504140 18:58031205-58031227 AATCATAGCACTCTACAGCCTGG + Intergenic
1158566433 18:58557881-58557903 GATCATAGCTCACTGCAGCCTGG - Intronic
1158612557 18:58955189-58955211 GATCATGGTTCACTGCACCCTGG - Intronic
1158709932 18:59828478-59828500 GATCATAGCTCACTGCATCCTGG - Intergenic
1158800845 18:60906691-60906713 GATCATGGCTCACTGCAGCCTGG - Intergenic
1158962009 18:62595453-62595475 GATCACAGTTCACTACAGCCTGG + Intergenic
1159234511 18:65653505-65653527 GATCACTGAGCACTCCAGCCTGG + Intergenic
1159959426 18:74544018-74544040 GATCATAGCTCACTGCAGCCTGG - Intronic
1160302156 18:77691681-77691703 CATGCTACTGCACTACAGCCTGG - Intergenic
1160439799 18:78880642-78880664 GATCACAACGCACTCCAGCCTGG - Intergenic
1160971774 19:1771721-1771743 CATGATACTGCACTCCAGCCTGG - Intronic
1161081277 19:2311506-2311528 GATCATGGCTCACTGCAGCCTGG + Intronic
1161261980 19:3342994-3343016 AATCATAGCTCACTGCAGCCTGG - Intergenic
1161263953 19:3354520-3354542 GATCACAGCACACTACAGCCTGG + Intergenic
1161275166 19:3412146-3412168 GATCATAGCTCACTGCAGCCTGG + Intronic
1161425712 19:4201838-4201860 GATCACACTGCACTCTAGCCTGG + Intronic
1161681841 19:5683826-5683848 GACCATAGCTCACTGCAGCCTGG - Intronic
1161792835 19:6370959-6370981 GATCATAGCTCACTGCAGCCTGG - Intergenic
1161833329 19:6626369-6626391 GGTGACAGTGCACTCCAGCCTGG + Intergenic
1161916776 19:7234270-7234292 GATCATAACTCACTGCAGCCTGG + Intronic
1161939486 19:7394082-7394104 GATTATAGCTCACTGCAGCCTGG + Intronic
1161939499 19:7394151-7394173 GATCATAGCTCACCGCAGCCTGG + Intronic
1162006720 19:7785753-7785775 TATCATAGCTCACTACAGCCTGG + Intergenic
1162050836 19:8031738-8031760 GATCATAGCTCACTACAGCCTGG - Intronic
1162063949 19:8113335-8113357 AATCATAGCTCACTGCAGCCTGG + Intronic
1162077490 19:8197721-8197743 GATCATAGCTTACTGCAGCCAGG - Intronic
1162233714 19:9288177-9288199 GATTATAGCTCACTGCAGCCTGG - Intergenic
1162337814 19:10072513-10072535 GATCACAGTGCATTCCAGCCAGG + Intergenic
1162424551 19:10586666-10586688 GATCATAGCTCACTGCAGCCTGG - Intronic
1162431166 19:10629641-10629663 GATCATAGCTCGCTACAGCCTGG + Intronic
1162492310 19:11000459-11000481 AAACACAGTGCACTGCAGCCTGG - Intronic
1162561478 19:11420356-11420378 GATCATAGCTCACTGCAGCCTGG + Intergenic
1162564345 19:11436921-11436943 GATCGTAGCTCACTGCAGCCTGG + Intronic
1162579014 19:11516585-11516607 AATCATAGCTCACTGCAGCCTGG - Intronic
1162816490 19:13198468-13198490 GATCATGGCTCACTGCAGCCTGG - Intergenic
1162836783 19:13324806-13324828 GATCATAGCTCTCTGCAGCCTGG - Intronic
1162898063 19:13777309-13777331 GATCATAGCTCACTGCAGCCTGG + Intronic
1162920744 19:13901036-13901058 AATCATAGCTCACTGCAGCCTGG + Intronic
1162924880 19:13925531-13925553 GATCGCACTGCACTCCAGCCTGG + Intronic
1162939591 19:14000730-14000752 GATCATAGCTCACTGAAGCCTGG - Intronic
1162963660 19:14144701-14144723 GATCACACTCCACTCCAGCCTGG - Intergenic
1163074884 19:14880992-14881014 GATCATAGGCCATCACAGCCAGG + Exonic
1163089835 19:15011886-15011908 CATCATAGTTCACTGCAACCTGG - Intronic
1163119542 19:15208870-15208892 GATCATAGCTCACTGCAGCCTGG - Intergenic
1163301849 19:16452552-16452574 GATCATAGCTCACTGCAGCCTGG - Intronic
1163396830 19:17068718-17068740 GATCACACTGCACTCCAGCCTGG + Intronic
1163437636 19:17304845-17304867 TATCATTGCTCACTACAGCCTGG + Intronic
1163439629 19:17315519-17315541 AATCATAGCTCACTGCAGCCTGG - Intronic
1163475997 19:17526580-17526602 GATCATGGCTCACTGCAGCCTGG - Intronic
1163678454 19:18667202-18667224 GATCATGCTGCACTGCAGCCTGG - Intronic
1163719259 19:18890713-18890735 GATCACAGCTCACTGCAGCCTGG - Intronic
1163778136 19:19229934-19229956 TATCATAGCTCACTGCAGCCTGG - Intronic
1163818806 19:19484368-19484390 GATCATAGTTCAATGTAGCCTGG - Intronic
1164039876 19:21484821-21484843 GATCACAGCTCACTGCAGCCTGG + Intronic
1164164218 19:22654643-22654665 GATGACACTGCACTCCAGCCTGG - Intronic
1164255327 19:23523333-23523355 GATGCTACTGCACTGCAGCCTGG + Intergenic
1164451197 19:28366627-28366649 GATCACAGCTCACTGCAGCCTGG + Intergenic
1164484722 19:28645198-28645220 AATCATAGCTCACTGCAGCCTGG + Intergenic
1164626110 19:29729172-29729194 AATCATAGCTCACTGCAGCCTGG + Intergenic
1164758597 19:30709667-30709689 GGTACCAGTGCACTACAGCCTGG - Intronic
1164781744 19:30898252-30898274 GATCGCACTGCACTCCAGCCTGG - Intergenic
1165063629 19:33216938-33216960 GATCATAGCTTACTGCAGCCTGG + Intronic
1165126213 19:33599799-33599821 GATCATAGCTCACTGCAGCTTGG - Intergenic
1165128129 19:33615299-33615321 CATGCCAGTGCACTACAGCCTGG - Intergenic
1165197633 19:34117373-34117395 TGTCATTGTGCACTACAGCCTGG + Intergenic
1165308463 19:35016548-35016570 GATCACACTGCACTCCAGCCTGG + Intronic
1165312591 19:35037891-35037913 AATCATAGCCCACTGCAGCCTGG - Intronic
1165396378 19:35566182-35566204 CATGACACTGCACTACAGCCTGG - Intergenic
1165399612 19:35589681-35589703 GATACTACTGCACTTCAGCCTGG + Intergenic
1165479942 19:36056851-36056873 CAACCCAGTGCACTACAGCCTGG - Intronic
1165543966 19:36517875-36517897 GATCGCACTGCACTCCAGCCTGG - Intronic
1165552618 19:36601484-36601506 GATCATAGCTCACTACAGCCTGG - Intronic
1165557305 19:36645160-36645182 GATCACAGCTCACTGCAGCCTGG - Intronic
1165800557 19:38546884-38546906 GATCACAGCTCACTGCAGCCTGG - Intronic
1165925371 19:39322824-39322846 GATCACAGCTCACTGCAGCCTGG + Intergenic
1166070304 19:40383481-40383503 GATCATAGTTCACTGTAGCCTGG + Intronic
1166093503 19:40525386-40525408 AATCATAGCTCACTGCAGCCTGG + Intronic
1166145794 19:40834311-40834333 GATCATAGCTCACCATAGCCAGG - Intronic
1166149898 19:40865205-40865227 GATCATAGCTCACCATAGCCAGG - Intronic
1166221744 19:41369439-41369461 CATCATAGCTCACTGCAGCCTGG - Intronic
1166308514 19:41949201-41949223 GATCATAACTCACTGCAGCCTGG + Intergenic
1166314662 19:41982328-41982350 CATAATAGTGCAAAACAGCCAGG + Intronic
1166662321 19:44655147-44655169 GATCATAGCTCACTGCAGCCTGG + Intronic
1166682247 19:44776343-44776365 GATCATAGCTCACTGCAGCCTGG - Intergenic
1166728984 19:45047344-45047366 GATCACAGTTCACTGCAGCCTGG - Intronic
1166760191 19:45219348-45219370 CATGATACTGCACTCCAGCCTGG + Intronic
1166769920 19:45275417-45275439 GATCATAGTTCGCTGTAGCCTGG - Intronic
1166775470 19:45309488-45309510 GATCATAGCTCGCTGCAGCCTGG - Intronic
1166836788 19:45672075-45672097 CATCATAGTTCACTGCAGCCTGG + Intronic
1166869096 19:45860052-45860074 AATCATACTTCACTACAACCAGG - Intronic
1166952351 19:46437911-46437933 CATCATAGCTCACTGCAGCCTGG - Intergenic
1166989523 19:46683040-46683062 AATGATACTGCACTTCAGCCTGG - Intronic
1167006623 19:46780266-46780288 GATCACAGCTCACTGCAGCCCGG - Intronic
1167158507 19:47753375-47753397 GATCATAGCTCACTGCAGCCTGG - Intronic
1167164359 19:47788370-47788392 GATCACGGTTCACTGCAGCCTGG + Intergenic
1167198087 19:48044493-48044515 AATCGTAGTTCACTGCAGCCTGG - Intergenic
1167218713 19:48183148-48183170 GGTGATAGAGCACTCCAGCCTGG - Intronic
1167476294 19:49703251-49703273 GGTGCCAGTGCACTACAGCCTGG - Intronic
1167489854 19:49786179-49786201 GATCACAGCTCACTGCAGCCTGG - Intronic
1167820830 19:51926547-51926569 GATCATAGCTCACTGCAGCCTGG + Intronic
1167873539 19:52392885-52392907 AATCATAGCTCACTGCAGCCTGG + Intergenic
1167889687 19:52529314-52529336 GATCTCAGTTCACTGCAGCCTGG - Intronic
1167959060 19:53091289-53091311 GATTGTAGTTCACTGCAGCCTGG - Intronic
1168000335 19:53440720-53440742 GATCATGCTGCACTCCATCCTGG - Intronic
1168004825 19:53478214-53478236 GATCATGCTGCACTCCATCCTGG - Intronic
1168122273 19:54258171-54258193 GATCATACCTCACTACAGCCTGG - Intronic
1168411546 19:56143290-56143312 GATCACAGGTCACTACACCCTGG - Intronic
1168648296 19:58075914-58075936 GATCATAGTTCTCTGTAGCCTGG + Intronic
1168664136 19:58190192-58190214 GATCGCACTGCCCTACAGCCTGG - Intronic
925563082 2:5219494-5219516 GATCATAGCTCATTGCAGCCTGG + Intergenic
926202378 2:10811429-10811451 CATCATAGTTCACTGCAGCCTGG - Intronic
926650344 2:15337269-15337291 TATAATCGTGCACTCCAGCCTGG + Intronic
926970753 2:18464674-18464696 GATCATAGCTCACAGCAGCCTGG - Intergenic
927211861 2:20643865-20643887 GATCATAGCTCAGTGCAGCCTGG - Intronic
927692464 2:25217736-25217758 GATCACAGCTCACTAAAGCCTGG - Intergenic
927923904 2:26996216-26996238 GATCATAGCTCACTGCAGCCTGG + Intronic
927938856 2:27091128-27091150 CATGATACTGCACTCCAGCCTGG - Intronic
927951719 2:27174835-27174857 AATCATAGCTCACTGCAGCCTGG - Intergenic
927951809 2:27175478-27175500 GATCATAGCTCAGTACAGCCTGG + Intergenic
928031312 2:27782225-27782247 AATCATAGCTCACTGCAGCCTGG + Intronic
928164691 2:28962217-28962239 CATGACAGTGCACTCCAGCCTGG - Intronic
928340996 2:30442991-30443013 CATCATAGCTCACTGCAGCCTGG - Intergenic
928366669 2:30708240-30708262 CATGCTAGTGCACTCCAGCCTGG + Intergenic
928563430 2:32516548-32516570 TATCATACTGCACTCCAGTCTGG + Intronic
928575347 2:32648944-32648966 GATCACAGCTCACTGCAGCCTGG - Intronic
928616882 2:33049905-33049927 GATCACAGCTCACTGCAGCCTGG + Intronic
928618704 2:33067104-33067126 GATCACAGCTCACTGCAGCCTGG - Intronic
928689778 2:33787437-33787459 GATCATAGCTCACTGCAACCTGG - Intergenic
928842782 2:35630680-35630702 GATCATGGTTCACTATACCCAGG + Intergenic
928934973 2:36666666-36666688 GATCATAGCTCACTGTAGCCTGG + Intergenic
928998918 2:37325835-37325857 GATCATAGCTCACTGCAGCCTGG + Intergenic
929502265 2:42500491-42500513 GATGCCAGTGCACTCCAGCCTGG + Intronic
929738552 2:44577551-44577573 GATCATAGATCACTGCAGCCTGG - Intronic
930165397 2:48199006-48199028 GATCCTAGTCAAATACAGCCAGG - Intergenic
930204675 2:48576234-48576256 GATCCCACTGCACTCCAGCCTGG - Intronic
930321226 2:49857028-49857050 GAACATGGTTCACTGCAGCCTGG - Intergenic
930667875 2:54117359-54117381 AATCATAGCTCACTGCAGCCTGG + Intronic
930745315 2:54877046-54877068 GATCATGGCTCACTGCAGCCTGG + Intronic
930873434 2:56189336-56189358 GATCACGATACACTACAGCCTGG - Intronic
931259707 2:60606563-60606585 GAGCATACTGCACTCCTGCCTGG + Intergenic
931354033 2:61518185-61518207 AATCATGGTTCACTGCAGCCTGG - Intronic
931367223 2:61629379-61629401 TATCACAGTTCACTACAGCCTGG + Intergenic
931411085 2:62032468-62032490 GATCATAGCTCACTGCAGCCAGG - Intronic
931447641 2:62340213-62340235 TATCATAGCTCACTGCAGCCTGG + Intergenic
932074099 2:68646980-68647002 GAACATAGCTCACTGCAGCCTGG - Intronic
932186359 2:69699566-69699588 GATCATAGCTCACTGCAGCCTGG - Intronic
932253414 2:70264026-70264048 GATCATGGCTCACTGCAGCCTGG + Intronic
932313596 2:70764716-70764738 GATCATAGTTCCCTGTAGCCGGG - Intronic
932385087 2:71324788-71324810 GATCATTGCTCACTGCAGCCTGG + Intronic
932725886 2:74179299-74179321 GTTCACAGTTCACTGCAGCCTGG + Intergenic
933061353 2:77740655-77740677 GATGCCAGTGCACTCCAGCCTGG + Intergenic
933319343 2:80753810-80753832 CATCCTACTGCACTCCAGCCTGG + Intergenic
933509655 2:83223886-83223908 GATCATAGCTCACTGCAGCCTGG - Intergenic
933513683 2:83274321-83274343 GATGCTATTGCACTCCAGCCTGG - Intergenic
933574107 2:84047514-84047536 GATCATAGCTCACTGCAGCCTGG - Intergenic
933915630 2:86989976-86989998 GATCATAGTTCACTGAAGCCTGG - Intronic
934007363 2:87779926-87779948 GATCATAGTTCACTGAAGCCTGG + Intronic
934321912 2:91978821-91978843 GATCACAGCTCACTGCAGCCTGG + Intergenic
934684668 2:96311972-96311994 GATCATACCGCACTATAGCCTGG - Intergenic
934967323 2:98733771-98733793 GATCATATTTCATTGCAGCCTGG - Intergenic
935009764 2:99122745-99122767 GATGCCACTGCACTACAGCCTGG + Intronic
935115619 2:100133508-100133530 GATCATAGTGACTTACAGCCTGG + Intronic
935138343 2:100328179-100328201 GATCATGGCTCACTGCAGCCTGG + Intergenic
935142555 2:100366364-100366386 GAGCAGAGATCACTACAGCCAGG - Intergenic
935245216 2:101213109-101213131 AATCATAGCTCACTGCAGCCTGG + Intronic
935249888 2:101252349-101252371 GATCACAGCTCACTGCAGCCTGG + Intronic
935265500 2:101390171-101390193 GATCATGGCTCACTGCAGCCTGG + Intergenic
935771005 2:106420839-106420861 GATCATAGTTCACTGAAGCCTGG + Intronic
935872168 2:107462857-107462879 GATCATACCTCACTGCAGCCTGG + Intergenic
935909076 2:107875098-107875120 GATCATAGTTCACTGAAGCCTGG - Intronic
935995753 2:108770553-108770575 GATCACAGTTCACTAAAGCCTGG - Intronic
935996072 2:108774393-108774415 AATCATAGCGCACTGCAGCCTGG - Intronic
936130856 2:109840224-109840246 GATCATAGTTCACTGAAGCCTGG - Intronic
936154413 2:110039014-110039036 GATCATAGCTCACTGCATCCTGG + Intergenic
936171249 2:110177805-110177827 GATTATAGCTCACTGCAGCCTGG + Intronic
936190269 2:110332400-110332422 GATCATAGCTCACTGCATCCTGG - Intergenic
936213841 2:110531261-110531283 GATCATAGTTCACTGAAGCCTGG + Intronic
936422979 2:112385821-112385843 GATCATAGTTCACTGAAGCCTGG + Intronic
936476604 2:112845101-112845123 AATCATGGTTCACTACAGCCTGG - Intergenic
936548394 2:113412938-113412960 CATCATCATGCACTACTGCCGGG - Intergenic
936592098 2:113813907-113813929 GATCATTGTACACTAAATCCTGG + Intergenic
936595690 2:113845426-113845448 GATCATAGCCCACTGCAGCCTGG + Intergenic
937564109 2:123262574-123262596 GGTGCTACTGCACTACAGCCTGG + Intergenic
937593345 2:123642107-123642129 GATCATAGCTCACTGCAGCCTGG + Intergenic
938020120 2:127899460-127899482 AATCATGGTTCACTGCAGCCTGG - Intergenic
938237661 2:129719642-129719664 GGTGATATTGCACTCCAGCCTGG + Intergenic
938393062 2:130920172-130920194 GATCACGGTTCACTGCAGCCTGG + Intronic
938415110 2:131097722-131097744 GATGCTACTGCACTCCAGCCTGG + Intergenic
938586611 2:132696951-132696973 GATCACGGTTCACTGCAGCCTGG + Intronic
938788969 2:134659891-134659913 CACTATACTGCACTACAGCCTGG + Intronic
939566470 2:143791624-143791646 AATCATAGCTCACTGCAGCCTGG + Intergenic
939577690 2:143915764-143915786 GATTATAGTGCACTACTGCCTGG + Intergenic
939968593 2:148635535-148635557 GATCCTACTGCACTCCAGCTTGG + Intergenic
940016320 2:149109753-149109775 CATGACACTGCACTACAGCCTGG - Intronic
940297194 2:152139488-152139510 GAGCATAGCACGCTACAGCCTGG - Intronic
940687268 2:156868537-156868559 GATCATAGCTTACTGCAGCCTGG + Intergenic
940807222 2:158201451-158201473 CATAATACTGCACTCCAGCCTGG - Intronic
940867989 2:158836213-158836235 AAACATTGTGCACTCCAGCCTGG + Intronic
941090216 2:161166718-161166740 AATCATAGCCCACTGCAGCCTGG - Intronic
941152597 2:161933456-161933478 AATCATAGCTCACTGCAGCCTGG + Intronic
941688304 2:168470315-168470337 AATCATAGTTCATTGCAGCCTGG - Intronic
941874892 2:170422266-170422288 CATCATAGCTCACTGCAGCCTGG + Intronic
941950077 2:171146256-171146278 AATCATAGCTCACTGCAGCCTGG - Intronic
941952697 2:171173429-171173451 GAAACCAGTGCACTACAGCCTGG - Intronic
941999262 2:171629700-171629722 AATCATAGCTCACTGCAGCCTGG - Intergenic
942002338 2:171661026-171661048 GATGCCACTGCACTACAGCCTGG - Intergenic
942103272 2:172607223-172607245 AATCATAGCTCACTGCAGCCTGG - Intronic
942155703 2:173124920-173124942 AATCATAGCTCACTATAGCCTGG - Intronic
942178705 2:173358462-173358484 GATCATAGCTTACTACAACCTGG - Intronic
942337107 2:174900436-174900458 GATCATAGCTCACTGTAGCCTGG - Intronic
943229765 2:185233965-185233987 GATCATAACTCACTGCAGCCTGG - Intergenic
943583401 2:189710734-189710756 GATCACAGCTCACTGCAGCCTGG - Intronic
944050873 2:195467963-195467985 GAAGATAGAGCACTAGAGCCAGG - Intergenic
944071261 2:195672194-195672216 GATCTTGGCTCACTACAGCCTGG + Intronic
944132329 2:196360037-196360059 GATCATAGCTCACTGCAGTCTGG - Intronic
944155254 2:196600848-196600870 GATCGTAGCACACTGCAGCCTGG - Intergenic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
944427869 2:199602559-199602581 GATCATGGCTCACTGCAGCCTGG - Intergenic
944479783 2:200144709-200144731 GAACATGGTGCCCTACATCCTGG - Intergenic
944713380 2:202355838-202355860 GATCATAGCTCACTGCAGCCTGG + Intergenic
944806529 2:203287151-203287173 GATCGTAGCTCACTCCAGCCTGG - Intronic
944984840 2:205164387-205164409 GATTATACTGCATTACAGTCTGG - Intronic
945106962 2:206325483-206325505 CATCATAGCTCACTGCAGCCTGG + Intergenic
945468866 2:210203739-210203761 AATCATAGTTCATTACATCCTGG + Intronic
946203733 2:218088412-218088434 CATGCTACTGCACTACAGCCTGG + Intronic
946268889 2:218572563-218572585 GATCATGGCTCACTGCAGCCTGG - Intronic
946333126 2:219021609-219021631 GATCATAGTGCACTGCAGCGTGG + Intronic
946642899 2:221803225-221803247 GATCATAGCTCACTACAGCCTGG - Intergenic
946820603 2:223625294-223625316 GATCATAGCTCACTGCAGTCTGG - Intergenic
947343516 2:229165512-229165534 GATCATAGCTCACTGCAGCCTGG - Intronic
947425768 2:229981634-229981656 AATCACAGCGCACTACAGCCTGG - Intronic
947547676 2:231022371-231022393 GATCACAGCTCACTGCAGCCTGG + Intronic
947605339 2:231482398-231482420 GATCTCACTGCACTCCAGCCTGG - Intronic
947621002 2:231591046-231591068 GATCACAGCTCACTGCAGCCTGG + Intergenic
947679490 2:232017131-232017153 GATTGTACTGCACTCCAGCCTGG - Intronic
947785279 2:232812933-232812955 GATCATAGCTCACTGCAGCCTGG - Intronic
947837615 2:233187116-233187138 GATCATAGCTTACTGCAGCCTGG - Intronic
947856436 2:233327587-233327609 GGTCACATTGCACTCCAGCCTGG - Intronic
947923673 2:233902054-233902076 GATTACAGCCCACTACAGCCTGG + Intergenic
947945413 2:234097725-234097747 GATTATAGTTCACCACAGCCTGG + Intergenic
948107041 2:235422725-235422747 CACCATACTGCACTCCAGCCTGG - Intergenic
948404571 2:237707365-237707387 GATCACAGCTCACTGCAGCCAGG - Intronic
948507840 2:238442163-238442185 GATGGTACTGCACTCCAGCCTGG - Intronic
948514236 2:238493523-238493545 GATCATAGCTCACTGTAGCCTGG + Intergenic
948962084 2:241347178-241347200 GACCATAGCTCACTGCAGCCTGG - Intronic
1168751087 20:281899-281921 GATCATGGCTCACTGCAGCCTGG - Intronic
1168755724 20:316093-316115 GATCATGGCTCACTGCAGCCTGG + Intergenic
1168755847 20:317124-317146 GATCATAGCTCACTGCATCCTGG - Intergenic
1168798644 20:629413-629435 GATCACAGCTCACTGCAGCCTGG + Intergenic
1168964305 20:1889970-1889992 AATCATAGGTCACTGCAGCCTGG + Intergenic
1169222277 20:3831748-3831770 GATCACAGCTCACTGCAGCCTGG + Intergenic
1169370561 20:5025929-5025951 GATCATGGCTCACTGCAGCCTGG + Intergenic
1169876418 20:10302158-10302180 GATCATAGCTCACTGCAGCCTGG - Intronic
1170447601 20:16445132-16445154 AATCATAGCTCACTGCAGCCTGG - Intronic
1170591198 20:17773226-17773248 GATCATGGCTCACTGCAGCCTGG - Intergenic
1170608792 20:17894972-17894994 GTTCATAGCTCACTGCAGCCTGG - Intergenic
1170761621 20:19256031-19256053 CATCATAGGTCACTGCAGCCTGG - Intronic
1171427855 20:25059556-25059578 CATCACAGCTCACTACAGCCTGG + Intergenic
1171448140 20:25218923-25218945 CATGCTAGTGCACTCCAGCCTGG - Intronic
1171968889 20:31550910-31550932 GATCATAGCTCACTTCAGCCTGG - Intronic
1171990522 20:31692865-31692887 CACCACACTGCACTACAGCCTGG + Intronic
1172084027 20:32364599-32364621 GATCATAGTGCACTAGAGCCTGG + Intronic
1172087942 20:32403478-32403500 GATCATAGTTCACTGCTGCCTGG + Intronic
1172305531 20:33877559-33877581 GATCATAGCTCACTGCAGCCTGG + Intergenic
1172369998 20:34381796-34381818 GATCATGGCTCACTATAGCCTGG - Intronic
1172412326 20:34734401-34734423 GATCCCATTGCACTCCAGCCTGG - Intronic
1172505394 20:35457753-35457775 CATGCCAGTGCACTACAGCCTGG + Intronic
1172607889 20:36227249-36227271 GATCATAGCTCATTGCAGCCTGG - Intronic
1172730051 20:37079530-37079552 GATCATAGCTCACTATAGTCTGG + Intronic
1172737865 20:37141856-37141878 GATCACAGCTCACTGCAGCCTGG + Intronic
1172955059 20:38750673-38750695 GATCCCACTGCACTCCAGCCTGG - Intronic
1173318168 20:41963430-41963452 GGGCATAGTTCACTGCAGCCTGG - Intergenic
1173747224 20:45447268-45447290 CATGCTACTGCACTACAGCCTGG - Intergenic
1173926833 20:46787103-46787125 GATCGCACTGCACTCCAGCCTGG + Intergenic
1173937863 20:46883373-46883395 GAGCCTACTGTACTACAGCCTGG - Intergenic
1174003075 20:47388996-47389018 GATCACAGCTCACTGCAGCCTGG + Intergenic
1174127966 20:48321339-48321361 AATCACACTGCACTCCAGCCTGG - Intergenic
1174224593 20:48986763-48986785 GATCACAGATCACTGCAGCCTGG + Intronic
1174235057 20:49082883-49082905 GATCATAGCTTACTTCAGCCAGG + Intronic
1174361889 20:50034156-50034178 GATCATAGTCCACTGCAGGCTGG + Intergenic
1174507286 20:51024577-51024599 CATCATAGTGCACTATAACCTGG - Intergenic
1174636546 20:52005644-52005666 GAACATAGCTCACTGCAGCCTGG - Intergenic
1174656092 20:52173520-52173542 AATCATAGCTCACTGCAGCCTGG - Intronic
1174778932 20:53370718-53370740 GATGACACTGCACTCCAGCCTGG + Intronic
1174828938 20:53795392-53795414 GATCATGGCTCACTACAACCTGG + Intergenic
1174886434 20:54340151-54340173 CATCATAGCTCACTGCAGCCTGG - Intergenic
1174912159 20:54618949-54618971 TATCATAGCTCACTGCAGCCTGG - Intronic
1175222894 20:57427424-57427446 AATCATAGCTCACTGCAGCCTGG - Intergenic
1175804241 20:61818610-61818632 AATCATAGCTCACTGCAGCCTGG - Intronic
1175805367 20:61825356-61825378 CATGACAGTGCACTCCAGCCTGG + Intronic
1175830498 20:61962787-61962809 AATCATAGCTCACTGCAGCCTGG - Intronic
1176016495 20:62936509-62936531 CATGACAGTGCACTCCAGCCTGG + Intronic
1176703666 21:10092296-10092318 GAGCACACTGCACTTCAGCCTGG - Intergenic
1177282115 21:18994327-18994349 GATCACGGGTCACTACAGCCTGG - Intergenic
1177791900 21:25731369-25731391 GCTCACAATGCACCACAGCCTGG + Intronic
1178163713 21:29948178-29948200 AATCATTGTTCACTGCAGCCTGG + Intergenic
1178338965 21:31769596-31769618 GATGACACTGCACTCCAGCCTGG - Intergenic
1178356941 21:31917256-31917278 GATCATAGGTCACTACAGCCTGG + Intronic
1178497182 21:33097125-33097147 AATCATAGCTCACTGCAGCCTGG + Intergenic
1178523662 21:33306596-33306618 GATCATGGCTCACTGCAGCCTGG + Intergenic
1179165474 21:38932182-38932204 GATCACAGCTCACCACAGCCTGG + Intergenic
1179219632 21:39394933-39394955 CCTCATAGCTCACTACAGCCTGG + Intronic
1179674120 21:42970421-42970443 CATGCTAGTGCACTTCAGCCTGG + Intergenic
1179843678 21:44095113-44095135 AATCATAGCTCACTGCAGCCTGG + Intronic
1179952302 21:44715574-44715596 GATCATGGCTCACTGCAGCCTGG + Intergenic
1180548654 22:16524748-16524770 GATCACAGCTCACTGCAGCCTGG + Intergenic
1180720093 22:17901624-17901646 CATGATACTGCACTCCAGCCTGG + Intronic
1180731694 22:17987173-17987195 GATCATAGCTCACTGCAGCCTGG - Intronic
1180963645 22:19774345-19774367 GATCGTAGCTCACTGCAGCCTGG - Intronic
1181115197 22:20628310-20628332 CATGATACTGCACTCCAGCCTGG + Intergenic
1181226604 22:21395404-21395426 GATACTACTGCACTCCAGCCTGG - Intergenic
1181252045 22:21539434-21539456 GATACTACTGCACTCCAGCCTGG + Intergenic
1181449788 22:23011899-23011921 GATCATAGCTCACTGCAGCCTGG - Intergenic
1181576845 22:23800692-23800714 GCTCATAGTGCAGTACACCATGG + Intronic
1181619717 22:24082153-24082175 GATCACAGCTCACTGCAGCCTGG + Intronic
1181929334 22:26387356-26387378 GATCACAGCTCACTGCAGCCTGG + Intergenic
1182176671 22:28297253-28297275 GATGCTACTGCACTCCAGCCTGG - Intronic
1182183358 22:28375020-28375042 GATCATAGCTCACTACATCCTGG - Intronic
1182210798 22:28675671-28675693 GATCACAGCTCACTGCAGCCTGG - Intronic
1182231131 22:28838244-28838266 GATCATGGCTCACTGCAGCCTGG - Intergenic
1182273488 22:29170503-29170525 AATCATAGCTCACTGCAGCCTGG - Intergenic
1182276283 22:29190704-29190726 AATCATAGCTCACTGCAGCCTGG - Intergenic
1182330952 22:29551683-29551705 GATCATAGCTCACTGCAGCCTGG - Intronic
1182335937 22:29583417-29583439 AATCATAACTCACTACAGCCTGG - Intergenic
1182508362 22:30801909-30801931 GATCATAGCTCACTGCAGCCTGG - Intronic
1182542576 22:31052391-31052413 GATCATGGTTCACTGCAGCCTGG - Intergenic
1182672274 22:32006328-32006350 GATCATGCTGCACTCCAGCCTGG - Intergenic
1182673422 22:32017211-32017233 CATGATACTGCACTCCAGCCTGG - Intergenic
1182740737 22:32565580-32565602 GATCCTAGCTCACTGCAGCCTGG + Intronic
1182810157 22:33109389-33109411 GATCATGGCACACTGCAGCCTGG + Intergenic
1182856242 22:33520068-33520090 GATCAGAGCTCACTGCAGCCTGG + Intronic
1183432002 22:37771575-37771597 GCCCATAGTGCCCTGCAGCCCGG - Intronic
1183435825 22:37794324-37794346 GACCATCTTGCACTCCAGCCTGG + Intergenic
1183901037 22:41006185-41006207 AATCATAGCTCACTGCAGCCTGG - Intergenic
1183996696 22:41639378-41639400 GATCATACTGCACTCTGGCCTGG - Intronic
1184147723 22:42621282-42621304 GATCATAATGCCCTCCAGCCTGG + Intronic
1184180944 22:42825186-42825208 AATCACAGTTCACTGCAGCCTGG - Intronic
1184806483 22:46797935-46797957 GATCATAGCTCACTGCAACCTGG + Intronic
1185303052 22:50093572-50093594 GATTATAGTTCACTGCAGCCTGG + Intronic
1185349876 22:50329358-50329380 CATCATAGCTCACTGCAGCCTGG + Intergenic
1185427388 22:50780464-50780486 AATCATAGCTCACCACAGCCTGG + Intronic
949256085 3:2048327-2048349 GATCATAGATTACTATAGCCTGG + Intergenic
949314776 3:2740292-2740314 AATCATAGCTCACTGCAGCCTGG - Intronic
949408212 3:3736612-3736634 AATCATAGGTCACTGCAGCCTGG - Intronic
949483054 3:4512051-4512073 GATCACAGCTCACTGCAGCCTGG + Intronic
949495328 3:4626071-4626093 AATCATAGCACACTACAGCCTGG - Intronic
949937478 3:9127269-9127291 AATCATAGCTCACTGCAGCCTGG - Intronic
950059320 3:10056595-10056617 GATCATACTTCACTGCAGCCTGG + Intronic
950295454 3:11825855-11825877 GATCATAGTTCACTGCAGCCTGG + Intronic
950325747 3:12108142-12108164 GATCATGGCTCACTGCAGCCTGG - Intronic
950390574 3:12693453-12693475 GGTGCTACTGCACTACAGCCTGG + Intergenic
950606040 3:14081132-14081154 GATCATACCTCACTGCAGCCTGG - Intronic
950682529 3:14594960-14594982 AATCACAGTTCACTGCAGCCTGG + Intergenic
950717440 3:14859514-14859536 CATCACACTGCACTCCAGCCTGG + Intronic
950722481 3:14893415-14893437 GACCATAGCTCACTGCAGCCTGG + Intronic
950734539 3:14994847-14994869 AATCATAGCTCACTGCAGCCTGG - Intronic
950813341 3:15672187-15672209 CATTATACTGCACTCCAGCCTGG - Intronic
951070272 3:18320197-18320219 GATCATGGCTCACTGCAGCCTGG + Intronic
951397347 3:22185512-22185534 GATCGCACTGCACTCCAGCCTGG - Intronic
951632026 3:24732433-24732455 GATCATAGCTCACTGCAGCCTGG + Intergenic
952021980 3:29034059-29034081 GATCACAGCTCAGTACAGCCTGG + Intergenic
952465780 3:33584319-33584341 GATCACACTGCACTCCAGCCTGG - Intronic
953313748 3:41906461-41906483 AATCATAGCTCACTGCAGCCAGG - Intronic
953409531 3:42682612-42682634 GATCACAATTCACTGCAGCCTGG - Intergenic
953513159 3:43564096-43564118 GATCACAGTTCACTGCAGCCTGG + Intronic
953594807 3:44300360-44300382 GATCTCAGTTCACTACAACCTGG - Intronic
953616259 3:44493279-44493301 GATCGTACTGCACTCCAGCCTGG - Intergenic
953648772 3:44780151-44780173 GATTCTAGTGCACCACAGCCTGG + Intronic
953838889 3:46372461-46372483 GATCATGGCTCACTGCAGCCTGG - Intronic
953887333 3:46722687-46722709 GATCATGGCTCACGACAGCCCGG - Intronic
953900247 3:46836303-46836325 GATCATGGCTCACTGCAGCCTGG - Intergenic
953987494 3:47456335-47456357 GATCATGGCTCACTACAGCCTGG - Intronic
954060777 3:48065062-48065084 GATCATAACTCACTGCAGCCTGG - Intronic
954118722 3:48482337-48482359 GATCACAGCTCACTGCAGCCTGG - Intronic
954353986 3:50069622-50069644 GATCATAGCTCACTGCAGCCTGG - Intronic
954482143 3:50810067-50810089 AATCATAGCTCACTGCAGCCTGG - Intronic
954549659 3:51470498-51470520 GATCATAGCTCACTGCAGCCTGG - Intronic
954560752 3:51554478-51554500 GATATTATTGCACTCCAGCCTGG + Intronic
954945179 3:54417850-54417872 GATCATGGCTCACTACAGCCCGG + Intronic
955138512 3:56245604-56245626 GATTGCAGTGCACTCCAGCCTGG - Intronic
955215138 3:56979086-56979108 AATCATAGTTCACTGCAGCCTGG - Intronic
955291280 3:57694341-57694363 GATCATAGCGCGCTGCAGCCTGG - Intergenic
955328666 3:58029014-58029036 GATTATAGTTCACTGCAGCTTGG - Intronic
955504049 3:59613583-59613605 CATCATAGCACACTACAGCCTGG - Intergenic
955505099 3:59624560-59624582 GCTCATAGTACAGTACGGCCAGG + Intergenic
955742925 3:62111513-62111535 GGTCATAGCTCACTGCAGCCTGG + Intronic
955832862 3:63023390-63023412 GATCATAGCTCAGTACATCCTGG + Intergenic
956310197 3:67870386-67870408 GATAACAGTTCACTGCAGCCTGG - Intergenic
956490809 3:69769679-69769701 CAGCAAAGTGCACTACAGCCCGG + Intronic
956796472 3:72722798-72722820 GATCACAGCCCACTGCAGCCTGG - Intergenic
956820752 3:72952044-72952066 GATGACACTGCACTCCAGCCTGG - Intronic
956855675 3:73272577-73272599 GATCACACTGCACTTCAGCCTGG - Intergenic
957248138 3:77738474-77738496 GATCATAGTTCACTGCAGCCTGG + Intergenic
957366363 3:79229510-79229532 GATCATAGCTCACTGTAGCCTGG + Intronic
957424008 3:80011820-80011842 GATGACACTGCACTCCAGCCTGG + Intergenic
957430679 3:80101779-80101801 CACCACAGTGCACTCCAGCCTGG - Intergenic
957823289 3:85407134-85407156 GATCACAGCTCACTGCAGCCTGG - Intronic
957955129 3:87176757-87176779 GTTCCAAGTGCACTACAGGCTGG + Intergenic
958096184 3:88948094-88948116 GCTCATAGTTCACAACTGCCTGG - Intergenic
959080795 3:101798999-101799021 GATCATAGCTCACTACAACCTGG + Intronic
959293061 3:104499408-104499430 GATTATAGCTCACTGCAGCCTGG - Intergenic
959548536 3:107626696-107626718 CATGCTACTGCACTACAGCCTGG - Intronic
959595019 3:108120161-108120183 GATCATGGCTCACTGCAGCCTGG - Intergenic
960627129 3:119692047-119692069 GATCACACTGCACTCTAGCCTGG + Intergenic
960771215 3:121194467-121194489 GATCATAGCTCACTGCAGCCTGG - Intronic
960791805 3:121440397-121440419 TATCATGGTTCACTGCAGCCTGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961145261 3:124587769-124587791 GATCATGGTTCACCACAACCAGG + Intronic
961161645 3:124731549-124731571 GATCATAGCTCACTGCAGCCTGG + Intronic
961179002 3:124861399-124861421 GATCATAGCCCACTGCAGCCCGG - Intronic
961692096 3:128677140-128677162 GATCATGGCTCATTACAGCCTGG + Intronic
961704855 3:128776333-128776355 GAACACAGCTCACTACAGCCTGG + Intronic
961744080 3:129052553-129052575 GATCCTAGCTCACTGCAGCCTGG - Intergenic
961949968 3:130739435-130739457 GATCACAGTTCACTGTAGCCTGG + Intronic
961974299 3:131006726-131006748 GATCATGGCTCACTGCAGCCTGG + Intronic
961987887 3:131157384-131157406 GATCATTGTCCATTACAGTCTGG + Intronic
962213393 3:133498496-133498518 AATCATAGCTCACTGCAGCCTGG - Intergenic
962321531 3:134394686-134394708 GATCACACTGTACTCCAGCCTGG - Intergenic
962550947 3:136491181-136491203 GATCATAGTTCACTGCACCCTGG + Intronic
962760309 3:138506297-138506319 TATGATAATGCACTTCAGCCTGG + Intronic
963090872 3:141482660-141482682 CATCCCAGTGCACTCCAGCCTGG - Intergenic
963164087 3:142183338-142183360 GATCTTACTGCACTCTAGCCTGG - Intronic
963207221 3:142649268-142649290 GATCATGGTTCACTGCAGCCTGG - Intronic
963343071 3:144061010-144061032 GATCATAGCTCACTGCAGCCTGG - Intergenic
963609020 3:147441948-147441970 AATCATAGCTCGCTACAGCCTGG + Intronic
963670256 3:148242369-148242391 AATCATGGTGCAGTACAACCTGG + Intergenic
963905237 3:150768188-150768210 AATCATAGTGCATTACAGCCTGG + Intergenic
963929592 3:150989656-150989678 GATCATAACTCACTGCAGCCTGG - Intergenic
964037351 3:152215448-152215470 GATCATAGCTCACTAAAACCTGG - Intergenic
964165911 3:153705057-153705079 CATGCTACTGCACTACAGCCTGG - Intergenic
964174689 3:153812088-153812110 GATCGTACTGCACTCCAGCCTGG + Intergenic
964328637 3:155575720-155575742 AATCATAGCTCACTGCAGCCTGG + Intronic
964706959 3:159629211-159629233 GATCACAGGTCACTGCAGCCTGG - Intronic
964797614 3:160516704-160516726 GATCACAGCTCACTTCAGCCTGG - Intronic
965151569 3:164983653-164983675 AATCATGGCTCACTACAGCCTGG + Intronic
965303437 3:167033773-167033795 GACCACACTGCACTCCAGCCTGG - Intergenic
965461111 3:168964700-168964722 CATCACATTGCACTCCAGCCTGG - Intergenic
965571716 3:170180381-170180403 GATCATAGCTCACTGCAGCCTGG - Intronic
965920432 3:173906781-173906803 GATCATAGCACACTGCAGCCTGG - Intronic
966247556 3:177825776-177825798 GATCGTACTGCACTCCAGCCTGG - Intergenic
966367456 3:179205146-179205168 GATCATAGCTGACTGCAGCCTGG - Intronic
966724489 3:183097456-183097478 GATCATGGCTCACTACGGCCTGG + Intronic
966835300 3:184045060-184045082 GATCACACTGCCCTCCAGCCTGG - Intergenic
966896832 3:184451393-184451415 CATGCTACTGCACTACAGCCTGG - Intronic
966968571 3:185020534-185020556 GATCATAGTTCACTGCATCCTGG + Intronic
967032346 3:185619791-185619813 GATCATAGCTCATTGCAGCCTGG + Intronic
967141222 3:186562277-186562299 AATCATAGCTCACTATAGCCTGG - Intronic
967164116 3:186765453-186765475 GGTGACAGTGCACTCCAGCCTGG + Intergenic
967290710 3:187917159-187917181 GATCACTGTCCACTCCAGCCGGG + Intergenic
967647467 3:191943836-191943858 GATCACAGTGCACTGCCGCCTGG + Intergenic
967809075 3:193740642-193740664 TGGCATAGTGCACTACAGCCCGG + Intergenic
968240576 3:197080342-197080364 GATCATGGCTCACTACTGCCTGG + Intronic
968336314 3:197916620-197916642 GGTGACACTGCACTACAGCCTGG - Intronic
968777613 4:2553261-2553283 TATCATCGCGCATTACAGCCTGG - Intronic
968796079 4:2705653-2705675 GGTCATAGCTCACTGCAGCCTGG + Intronic
968805635 4:2770150-2770172 CATCTCAGTGCACTTCAGCCTGG + Intergenic
968823363 4:2874148-2874170 AATCATAGCTCACTACAGCCTGG - Intronic
968926383 4:3550733-3550755 GATCATAGCTCACTGCAGCCTGG - Intergenic
969359247 4:6651456-6651478 AATCATAGCTCACTCCAGCCTGG - Intergenic
969380168 4:6790458-6790480 GATCACAGCTCACTACAGCCAGG + Intronic
969380409 4:6792731-6792753 GATGCCATTGCACTACAGCCTGG - Intronic
969661408 4:8531507-8531529 AATCATAGCTTACTACAGCCTGG + Intergenic
969993981 4:11292883-11292905 GAGCCTATTGCACTCCAGCCTGG - Intergenic
970094660 4:12449270-12449292 CATCATGGCGCACTACAGCTTGG - Intergenic
970144523 4:13021112-13021134 GATCATGGCTCACTGCAGCCTGG + Intergenic
970498428 4:16652014-16652036 GATCATAGTGCACTGTAACCTGG + Intronic
970587107 4:17524876-17524898 GATCACGGTTCACTGCAGCCTGG - Intronic
970601896 4:17647316-17647338 AATCATAGCTCACCACAGCCTGG + Intronic
970797223 4:19927553-19927575 AATCATAGCTCACTGCAGCCCGG + Intergenic
970914322 4:21315013-21315035 GATGATAGTGAAATACTGCCTGG + Intronic
971411648 4:26379243-26379265 GATCATAGCTCACTGCAGCCTGG + Intronic
972379150 4:38502942-38502964 GATCATGGCTCACTGCAGCCTGG - Intergenic
972414055 4:38821415-38821437 GATCATAGCTCACTGCAGCCTGG + Intronic
972446870 4:39152684-39152706 GATCATAGCTCACTGCAGCCTGG - Intergenic
972514011 4:39795766-39795788 GATCATAGCTCACTGCAGCTGGG + Intergenic
972569557 4:40298087-40298109 GTTGAGGGTGCACTACAGCCTGG - Intergenic
972597734 4:40545009-40545031 TATGATCGTGCACTCCAGCCTGG + Intronic
972617552 4:40714857-40714879 GATCACAGCTCACTGCAGCCTGG + Intergenic
972634283 4:40869520-40869542 GATCATAGCTCACTGCAGCCTGG - Intronic
972768571 4:42174279-42174301 CATGATGGTGCACTCCAGCCTGG + Intergenic
972801245 4:42477934-42477956 GATCAGGCTGCACTCCAGCCTGG + Intronic
972920489 4:43934486-43934508 GATCATAGCTCACTACAGCCTGG - Intergenic
973241597 4:47961682-47961704 GTTTACAGTGCACTCCAGCCTGG + Intronic
973287311 4:48432957-48432979 GATCACGCTGCACTCCAGCCTGG - Intergenic
973316230 4:48763394-48763416 GAACATAGCTCACTGCAGCCTGG - Intronic
973338380 4:48979314-48979336 GATCACAGCTCACTGCAGCCTGG - Intergenic
973752005 4:54030455-54030477 GATCATGGCTCACTGCAGCCTGG - Intronic
973815287 4:54613744-54613766 GATCACACTGCACTCCAGCCTGG + Intergenic
973861234 4:55067197-55067219 CATGATATTGCACTCCAGCCTGG - Intergenic
973962151 4:56122106-56122128 GATCATAACTCACTGCAGCCTGG - Intergenic
973980559 4:56305153-56305175 GATCATAGCTCACTGCAGCCTGG - Intronic
974007341 4:56571799-56571821 GATCACACTGCTCTCCAGCCTGG + Intronic
974134925 4:57803601-57803623 GATCATGGCTCACTACAGCCTGG + Intergenic
974321006 4:60349734-60349756 AATCATAGAGCACTCTAGCCTGG + Intergenic
974716527 4:65675479-65675501 GATCATAGCTCACTGCAGCCTGG + Intergenic
974792527 4:66711131-66711153 TATCATAGCTCACTGCAGCCTGG + Intergenic
974800927 4:66817113-66817135 GATCATAGCTCACTGCAGCCTGG + Intergenic
975091790 4:70412169-70412191 AATCATAGCTCACTACAGCCTGG - Intergenic
975126389 4:70787121-70787143 GATCACACTGCACTCCAGCCTGG + Intronic
975133208 4:70848657-70848679 CATGATACTGCACTCCAGCCTGG - Intergenic
975599356 4:76083130-76083152 GATTACAGCTCACTACAGCCTGG - Intronic
975606755 4:76162643-76162665 GATTATAGAGCAAGACAGCCAGG - Intronic
975708680 4:77136988-77137010 AATCACACTGCACTCCAGCCTGG - Intergenic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
976101452 4:81568251-81568273 TATCATAGCTCACTGCAGCCTGG + Intronic
976182079 4:82408287-82408309 GAGCCGAGTGCACTCCAGCCTGG + Intergenic
976257216 4:83111029-83111051 GATCATAATTCACTGCAGCCTGG + Intronic
976286010 4:83371736-83371758 GATCATGGCTCACTGCAGCCTGG - Intergenic
976523981 4:86064968-86064990 GATCACAGCTCACTGCAGCCTGG + Intronic
976596359 4:86898741-86898763 GATCATAGAGCACCACCTCCTGG - Intronic
976733526 4:88287537-88287559 GATCATGGTTCACTGCAGCCTGG - Intergenic
976945843 4:90766576-90766598 GATCATAGCTCACTGCAGCCTGG - Intronic
977202733 4:94136081-94136103 CATCATAGTGCACTACAGCCTGG - Intergenic
977281808 4:95049177-95049199 GATCATAGCTCACTGCAGGCTGG + Intronic
977596313 4:98885489-98885511 GATCCCACTGCACTCCAGCCAGG - Intronic
977955467 4:103020681-103020703 GATCGCACTGCACTCCAGCCGGG - Intronic
978173833 4:105706299-105706321 GATCTCAGTGCACTCCAACCTGG - Intronic
978508785 4:109492778-109492800 GATCGTGGTTCACTGCAGCCTGG + Intronic
978512722 4:109538848-109538870 TATCACAGTTCACTGCAGCCTGG + Intronic
978598357 4:110402518-110402540 GATCATAGCCCACTGCAGCCTGG + Intronic
978838161 4:113178190-113178212 GATCATAGCTAACTGCAGCCTGG - Intronic
978872875 4:113601759-113601781 GATCACAGCTCACTGCAGCCTGG + Intronic
979028897 4:115613899-115613921 GATCATGGCTCACTGCAGCCTGG - Intergenic
979235143 4:118391431-118391453 AGTCATAGCTCACTACAGCCTGG - Intergenic
979538332 4:121850228-121850250 GATCATGGCTCACTGCAGCCTGG + Intronic
979559633 4:122087712-122087734 CGGCATAGTGTACTACAGCCCGG + Intergenic
979574826 4:122277273-122277295 CATCATAGCTCACTATAGCCTGG - Intronic
979654743 4:123179382-123179404 CATAATACTGCACTCCAGCCTGG - Intronic
979655609 4:123189878-123189900 GATCATGGCTCACTGCAGCCCGG + Intronic
980057053 4:128088127-128088149 GATCATAGCTCACTGCAGCCTGG - Intronic
980375880 4:131948648-131948670 GAGCACACTGCACTTCAGCCTGG - Intergenic
980395055 4:132202125-132202147 GTTCATAGTAAACTATAGCCAGG - Intergenic
980761825 4:137244514-137244536 AATCATAGTTCACTGCAGTCTGG - Intergenic
980856163 4:138442926-138442948 GATCCCACTGCACTCCAGCCTGG + Intergenic
980906725 4:138955361-138955383 GATCATAGCTCACTGCAGCCTGG - Intergenic
980909501 4:138981139-138981161 CATTCTACTGCACTACAGCCTGG - Intergenic
980947019 4:139331488-139331510 GATGCCACTGCACTACAGCCTGG - Intronic
981102208 4:140841636-140841658 AATCACAGCTCACTACAGCCTGG + Intergenic
981468423 4:145100286-145100308 GATCACAGGACACTACAGACTGG - Intronic
981894532 4:149782533-149782555 GATCATAGCTCATTGCAGCCTGG - Intergenic
982154793 4:152508000-152508022 GATCATAGCTCACTGCAACCTGG - Intronic
982221422 4:153128633-153128655 GATCACAGTGCCCTGCAGCCTGG - Intergenic
982259558 4:153482655-153482677 TGTCATAGTGAACTGCAGCCTGG + Intronic
982268640 4:153564243-153564265 CATCTTATTGCACTCCAGCCTGG + Intronic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
982751045 4:159162348-159162370 GATAACACTGCACTCCAGCCTGG + Intronic
983182474 4:164665253-164665275 GATCATAGCACACTGCAGCCTGG + Intergenic
983264225 4:165490584-165490606 GATCACACTACACTCCAGCCTGG + Intronic
983433038 4:167675362-167675384 GATCATGGCGCACTGCAGCCTGG - Intergenic
983737866 4:171086222-171086244 GATCATGCTGCACTCCAGCCTGG + Intergenic
983841931 4:172467957-172467979 GATCATAGCTCACTACAGCCTGG + Intronic
983886040 4:172981844-172981866 TATCACACTGCACTCCAGCCTGG - Intronic
983901094 4:173135461-173135483 GATCCTAGCTCACTATAGCCTGG + Intergenic
984127191 4:175826092-175826114 GAACATGGCTCACTACAGCCTGG - Intronic
984681167 4:182610615-182610637 GATCATAGCTCATTGCAGCCTGG - Intronic
985584297 5:721059-721081 TATCACTGTGCACTCCAGCCTGG + Intronic
985597802 5:805386-805408 TATCACTGTGCACTCCAGCCTGG + Intronic
985937973 5:3111312-3111334 AATCATAGCTCACTGCAGCCTGG + Intergenic
986295823 5:6437650-6437672 CATCATAGCTCACTACAGCCTGG - Intergenic
987028524 5:13952846-13952868 AATCATAGCTCACTGCAGCCTGG + Intergenic
987029608 5:13963752-13963774 TATCATAGCTCACTACAGCCTGG + Intergenic
987042978 5:14080273-14080295 AACCATGGTGCACTCCAGCCTGG - Intergenic
987139715 5:14932520-14932542 GGTCATAGCACACTGCAGCCTGG - Intergenic
987266799 5:16264037-16264059 GATCATAGCTCATTGCAGCCTGG - Intergenic
987340144 5:16932844-16932866 AATCATGGTTCACTGCAGCCTGG + Intronic
987443487 5:17986599-17986621 AATCATAGCTCACTAAAGCCTGG - Intergenic
987507383 5:18792024-18792046 GATCATAGCTCACTGCAGCCTGG + Intergenic
987783643 5:22470482-22470504 GATCATAGCTCACTGCAGCCTGG + Intronic
988327220 5:29786041-29786063 TATAACAATGCACTACAGCCCGG + Intergenic
988497443 5:31757218-31757240 GGTCATAGCTCACTGCAGCCTGG - Intronic
988659277 5:33246881-33246903 GATCATGGCCCACTGCAGCCTGG + Intergenic
988993586 5:36693707-36693729 AATCATAGCGCACTGCAGCCTGG + Intergenic
989036529 5:37178545-37178567 GATCATGGCTCACTGCAGCCTGG - Intronic
989161465 5:38395307-38395329 AATCATAGATCACTACAGCCTGG + Intronic
989335144 5:40307489-40307511 CATCCTACTGCACTCCAGCCTGG - Intergenic
989572176 5:42954775-42954797 GATCATCGTTCACTGCAGCCTGG - Intergenic
989712425 5:44415568-44415590 AGTCATTGTGCACTATAGCCTGG + Intergenic
990311040 5:54539096-54539118 GATCATAGCTCATTGCAGCCTGG + Intronic
990422916 5:55654537-55654559 GATCATAGCTCACTGCAACCTGG - Intronic
991165042 5:63556218-63556240 AATCATAGCTCACTGCAGCCTGG - Intergenic
991205597 5:64046476-64046498 GGTTGCAGTGCACTACAGCCTGG + Intergenic
991718508 5:69474266-69474288 CATGACACTGCACTACAGCCTGG - Intergenic
991900321 5:71454132-71454154 TATCATAGCTCACTGCAGCCTGG + Intergenic
992056873 5:72998891-72998913 GATCATAGCTCACTGCAGCCTGG + Intronic
992133767 5:73721636-73721658 GATCATAGCTCACTGCAGCCTGG + Intronic
992259925 5:74959373-74959395 GATCATAGCTCACTACATCCTGG + Intergenic
992319997 5:75604440-75604462 GATCATAACTCACTGCAGCCTGG + Intergenic
992346612 5:75885613-75885635 AATTGTAGTGCACTACAGCCTGG + Intergenic
992400699 5:76408683-76408705 AATCATTGCACACTACAGCCTGG - Intronic
992569643 5:78042306-78042328 AATCATAGCTCACTGCAGCCTGG + Intronic
992701023 5:79342113-79342135 GATCATAGTTCACTGCAGCCTGG - Intergenic
992720340 5:79554624-79554646 GATCATGGATCACTGCAGCCTGG + Intergenic
992781166 5:80129362-80129384 AATCATAGCTCACTGCAGCCTGG + Intronic
992805814 5:80336735-80336757 AATCATAGCTCATTACAGCCTGG + Intergenic
992808762 5:80364641-80364663 AATCATCGCACACTACAGCCTGG + Intergenic
993472717 5:88325443-88325465 GATCATAGCTCACTGCAACCTGG + Intergenic
993745014 5:91586459-91586481 GCTCAAAGTGCACCACAGGCAGG + Intergenic
993813083 5:92507447-92507469 GATATTACTGCACTATAGCCTGG + Intergenic
994084070 5:95739614-95739636 GATCATAGCTCACTGCAACCTGG + Intronic
994183790 5:96796840-96796862 TATGATTGTGCACTCCAGCCTGG - Intronic
994217370 5:97153050-97153072 GATCACAGCTCACTGCAGCCTGG + Intronic
994252468 5:97552377-97552399 GATCCTGGTGCACTACAGCCTGG - Intergenic
994376485 5:99020673-99020695 GATCATAGCTCACTGCTGCCTGG - Intergenic
994626671 5:102229098-102229120 GATCACAGCTCACTGCAGCCTGG + Intergenic
994865750 5:105267557-105267579 GATCATAGTTCACTGAAGCCTGG + Intergenic
995194211 5:109345468-109345490 GATCACCATGCACTCCAGCCTGG + Intronic
995807352 5:116068429-116068451 TATGATTGTGCACTCCAGCCTGG - Intergenic
996064711 5:119068198-119068220 GATCATAGTTCACTGCAACCTGG + Intronic
996357668 5:122614955-122614977 CATGACAGTGCACTCCAGCCTGG + Intergenic
996428992 5:123349704-123349726 GATCACAGCTCACTGCAGCCTGG + Intronic
996721531 5:126635100-126635122 AATCATAGCTCACTGCAGCCTGG - Intronic
996764091 5:127018325-127018347 CATGACAGTGCACTCCAGCCTGG + Intronic
997033799 5:130162598-130162620 GATCATGGCTCACTCCAGCCTGG + Intronic
997162435 5:131623525-131623547 TACCATTGTGCACTCCAGCCTGG - Intronic
997221719 5:132172623-132172645 GATTGTACTGCACTCCAGCCTGG + Intergenic
997329448 5:133048647-133048669 GTTCATAGCTCACTGCAGCCTGG - Intergenic
997449518 5:133970516-133970538 GATGACAGTGCACTTCAGTCTGG + Intergenic
997483309 5:134206562-134206584 GATCATAGCTCACTGTAGCCTGG + Intronic
997503373 5:134396474-134396496 GATCACAGCTCACTACAGCCTGG + Intergenic
997537757 5:134635778-134635800 GATCATAGCTCACTGCAGCCTGG - Intronic
997864590 5:137449818-137449840 GATCATAGCTCACTACAGCCTGG - Intronic
997940166 5:138150159-138150181 GATGCTACTGCACTCCAGCCTGG - Intronic
998052201 5:139045280-139045302 AATCATGGCTCACTACAGCCTGG - Intronic
998057081 5:139087477-139087499 CATCATAGCTCACTGCAGCCTGG - Intronic
998145053 5:139722858-139722880 AATCATAGCTCACTGCAGCCTGG - Intergenic
998219468 5:140264777-140264799 GATCATAGCTCAGTGCAGCCTGG - Intronic
998504609 5:142661954-142661976 GATTACACTGCACTCCAGCCTGG + Intronic
998833284 5:146181584-146181606 GATCATGGCTCACTGCAGCCTGG - Intronic
999166588 5:149554262-149554284 GATCATAGCTCACAGCAGCCTGG - Intronic
999299024 5:150479015-150479037 GATCATGGCCCACTGCAGCCTGG - Intergenic
999472007 5:151863355-151863377 GATCATGGTTCACTGCAGCCTGG - Intronic
999582638 5:153056437-153056459 GATCATAGCTCATTGCAGCCTGG - Intergenic
999657408 5:153824389-153824411 AATCATATTGCACTACAGCCTGG - Intergenic
999882507 5:155882150-155882172 CATGACAGTGCACTCCAGCCAGG - Intronic
1000361979 5:160456245-160456267 GATCATGGCTCACTGCAGCCTGG + Intergenic
1000692581 5:164341891-164341913 AATCACATTGCACTCCAGCCTGG - Intergenic
1000779241 5:165459757-165459779 AATCATGGCTCACTACAGCCTGG + Intergenic
1000856467 5:166404146-166404168 GATCATAGGTCACTGCAGCCTGG + Intergenic
1000882770 5:166716564-166716586 GATCACACTGCACTCCAGCCTGG - Intergenic
1000888863 5:166780530-166780552 CATCATAGCTCACTGCAGCCTGG - Intergenic
1000928175 5:167219232-167219254 CATCATAGCTCACTGCAGCCTGG - Intergenic
1001511120 5:172322722-172322744 GATCATAGCTCACTGCAGCCTGG + Intergenic
1001722794 5:173870279-173870301 AATCACATTGCACTCCAGCCCGG + Intergenic
1001817578 5:174682983-174683005 CATCATAGCTCACTACAGCTTGG - Intergenic
1001972856 5:175970643-175970665 GATCGCACTGCACTCCAGCCTGG - Intronic
1002095855 5:176830285-176830307 GCTCACAGTGCGCTAAAGCCTGG + Intronic
1002121753 5:177010148-177010170 GATCATAGCTCACTGCAACCTGG - Intronic
1002121917 5:177011515-177011537 AATCATAGCTCACTGCAGCCTGG - Intronic
1002244582 5:177873146-177873168 GATCGCACTGCACTCCAGCCTGG + Intergenic
1002248723 5:177907165-177907187 GATCACACTGTACTCCAGCCTGG + Intergenic
1002321374 5:178378001-178378023 CAGCATTGTGCACTTCAGCCCGG - Intronic
1002328100 5:178423030-178423052 AATCATAGCTCACTGCAGCCTGG + Intronic
1002550528 5:179987231-179987253 GATCATGGCTCACTGCAGCCTGG + Intronic
1003038855 6:2669022-2669044 GATGACACTGCACTCCAGCCTGG + Intronic
1003059330 6:2850539-2850561 CATCATAGCTCACTATAGCCTGG + Intergenic
1003070623 6:2942683-2942705 GATCACGCTGCACTGCAGCCTGG + Intergenic
1003110842 6:3251034-3251056 AATCATAGCTCACTGCAGCCTGG + Intronic
1003208761 6:4039942-4039964 GATCACACTGCACTCCAGCCTGG - Intronic
1003402358 6:5800978-5801000 CATCGTCATGCACTACAGCCTGG + Intergenic
1003492629 6:6637052-6637074 CATCACACTGCACTCCAGCCTGG - Intronic
1003554313 6:7126329-7126351 GGTTGTAGTGCACTCCAGCCTGG - Intronic
1003631350 6:7790469-7790491 GATCGCACTGCACTCCAGCCAGG + Intronic
1003677106 6:8215520-8215542 GATCATAGCTCCCTGCAGCCTGG + Intergenic
1003733917 6:8856436-8856458 GATCATGGTTCACCGCAGCCTGG + Intergenic
1003768820 6:9273911-9273933 GATCATAGCTCACTGCAGCCTGG - Intergenic
1003859894 6:10313046-10313068 GATCACATTGCACTCCAGCCTGG + Intergenic
1003910035 6:10734795-10734817 GATCGCACTGCACTCCAGCCTGG + Intergenic
1004112059 6:12728251-12728273 GATCACAGCTCACTACAACCTGG - Intronic
1004341536 6:14812428-14812450 GATCATAGCTCACTGCAGCCTGG + Intergenic
1004962788 6:20810529-20810551 GATCATAGCTCACTGCAGCCTGG - Intronic
1005045829 6:21641401-21641423 GGTGATACTGCACTCCAGCCTGG - Intergenic
1005061608 6:21781943-21781965 GATCATGGATCACTGCAGCCTGG - Intergenic
1005316924 6:24612002-24612024 GATCACACTGCACTCCAGCCTGG + Intronic
1005346109 6:24892334-24892356 AATCATAGCTCACTAAAGCCTGG + Intronic
1005679603 6:28192945-28192967 GATCAGAGCTCACTGCAGCCTGG - Intergenic
1005768890 6:29044812-29044834 GATCATAGGACATAACAGCCAGG + Exonic
1005935681 6:30519204-30519226 GATCTTGGTTCACTACAACCTGG + Intergenic
1006007454 6:31013727-31013749 CATCATAGCTCACTGCAGCCTGG + Intronic
1006057689 6:31397715-31397737 AATCATAGCTCACTGCAGCCTGG + Intergenic
1006070176 6:31492711-31492733 AATCATAGCTCACTGCAGCCTGG + Intergenic
1006291275 6:33138904-33138926 CATAATACTGCACTCCAGCCTGG - Intergenic
1006306749 6:33226145-33226167 GATTATAGCTCACTGCAGCCTGG - Intergenic
1006320829 6:33318362-33318384 GATCACAGCTCACTGCAGCCTGG - Intergenic
1006329289 6:33378266-33378288 GATCACTGTGCACTATAACCTGG + Intergenic
1006659594 6:35629168-35629190 GATCATAGCTCACTGCAGCCTGG + Intronic
1006660673 6:35641042-35641064 GATCATAGTTCACTGCAGCTTGG + Intronic
1006664397 6:35680362-35680384 GATCATAGCTCACTGCAGCCTGG - Intronic
1006857692 6:37146998-37147020 CATCATAGCTCACTGCAGCCTGG + Intergenic
1007035141 6:38666356-38666378 AATCACAGTGCACTAGAGCCTGG - Intergenic
1007438478 6:41836010-41836032 GATCATAACTCACAACAGCCTGG - Intronic
1007496882 6:42266230-42266252 CATGCTACTGCACTACAGCCTGG - Intronic
1007557512 6:42779149-42779171 GATCATATCTCACTATAGCCTGG - Intronic
1007753909 6:44086497-44086519 GATCATAGCTCACTGCAGCCTGG - Intergenic
1007760468 6:44130502-44130524 GATCTTGGTTCACTGCAGCCTGG + Intronic
1007770848 6:44191318-44191340 GATCATCAGGCACTATAGCCTGG + Intergenic
1007796681 6:44354266-44354288 GATCATGGCTCACTGCAGCCTGG - Intronic
1007852444 6:44816993-44817015 GATCATAGCTCACTGCAACCTGG - Intronic
1008081168 6:47195803-47195825 CATGCTACTGCACTACAGCCTGG - Intergenic
1008553109 6:52651818-52651840 GATCATAGCTCACTGCAACCTGG - Intergenic
1008600273 6:53086971-53086993 GATCATAGCTCACTGCAGCCAGG - Intronic
1010231996 6:73542920-73542942 GATCACACTGCACTCCAGCCTGG + Intergenic
1010233735 6:73557864-73557886 GATCATGGCTCACTGCAGCCTGG + Intergenic
1011278731 6:85655608-85655630 GATCATAGCTCACTGCAGCCTGG - Intergenic
1011281508 6:85682480-85682502 GATCACAGCTCACTGCAGCCTGG + Intergenic
1011418483 6:87147794-87147816 GATCATAGCTCACTACAGCCTGG - Intergenic
1011625437 6:89279570-89279592 GATCATAGCTCACTATAACCTGG + Intronic
1012577498 6:100821093-100821115 AATCATGGCTCACTACAGCCTGG + Intronic
1012902090 6:105018241-105018263 TATGCTACTGCACTACAGCCTGG + Intronic
1012994697 6:105961529-105961551 GATTACACTGCACTCCAGCCTGG + Intergenic
1013020900 6:106216809-106216831 GATCATAGTGCAGTACAGCCTGG - Intronic
1013142439 6:107350742-107350764 GATCATAGCTCACTGCATCCTGG - Intronic
1013239054 6:108225972-108225994 AATCATAGTTCACTACAGTCTGG - Intronic
1013248187 6:108308213-108308235 AATCATGGTTCACTGCAGCCTGG + Intronic
1013344257 6:109244627-109244649 CATCATAGTGCACTATAACCTGG - Intergenic
1013509797 6:110834271-110834293 GATCATAGTTCACTGCAGCCTGG - Intronic
1013660254 6:112288675-112288697 AATCATAGTTCATTGCAGCCTGG - Intergenic
1013776678 6:113686862-113686884 GATCACAGTTCACTGCAGCCTGG + Intergenic
1014158429 6:118138240-118138262 GATCATGGCTCACTGCAGCCTGG - Intronic
1014228738 6:118878094-118878116 TATCATAGCTCACTGCAGCCTGG - Intronic
1014523180 6:122470142-122470164 GGTCGTAGTGAACTGCAGCCTGG - Intronic
1015712371 6:136156253-136156275 AATCATAGCTCACTGCAGCCTGG + Intronic
1015744302 6:136493481-136493503 GAACATTGTTCACTACAGCCTGG + Intronic
1015759680 6:136644992-136645014 AATCATAGCTCACTACAGCCTGG + Intronic
1015905610 6:138113610-138113632 TATGATACTGCACTCCAGCCTGG + Intergenic
1015936373 6:138409090-138409112 GATCATAGCTCACTGCAGCCTGG + Intronic
1016008305 6:139111951-139111973 GATCTTACTGCACTCCAGCCTGG - Intergenic
1016414135 6:143815348-143815370 GATCATAGCTCACTGCTGCCTGG - Intronic
1016549342 6:145259400-145259422 GATGACATTGCACTAGAGCCAGG - Intergenic
1016564549 6:145438515-145438537 GATGACACTGCACTCCAGCCTGG - Intergenic
1016620262 6:146101025-146101047 AATCATAGCTCTCTACAGCCTGG - Intronic
1016675168 6:146756779-146756801 GATCTGAGATCACTACAGCCTGG - Intronic
1016773893 6:147882512-147882534 AAACATAGCGCACTGCAGCCTGG - Intergenic
1016953324 6:149602318-149602340 GATCGCACTGCACTCCAGCCTGG + Intronic
1016972174 6:149774579-149774601 GACAATATTGCACTCCAGCCTGG - Intronic
1017147440 6:151247355-151247377 CATGCTACTGCACTACAGCCTGG + Intronic
1017157040 6:151331928-151331950 GATCATAGCTCACTGCAGCCTGG + Intronic
1017423867 6:154300568-154300590 GACAACAGTGCACTCCAGCCTGG + Intronic
1017693429 6:156990237-156990259 CATCATAGCTCACTGCAGCCTGG + Intronic
1017930906 6:158954259-158954281 GATCAGAGCTCACTGCAGCCTGG + Intergenic
1018150399 6:160931779-160931801 GATCAAAGTGCCCTACACCAAGG - Intergenic
1018151820 6:160946824-160946846 GGTCCTACTGCACTCCAGCCTGG - Intergenic
1018198153 6:161372893-161372915 GATCATAGCTCACTCTAGCCTGG + Intronic
1018272968 6:162100491-162100513 GATGAGATTGCACTCCAGCCTGG - Intronic
1018290420 6:162287500-162287522 GATCATGGCTCACTGCAGCCTGG - Intronic
1019566743 7:1686376-1686398 GATCATAGCTCACTGCAGCCTGG + Intergenic
1019758506 7:2790906-2790928 GGTCATAGCTCACTGCAGCCTGG - Intronic
1019818223 7:3217161-3217183 AATCATAGCTCACTGCAGCCTGG - Intergenic
1019843615 7:3474754-3474776 GATCATAGCTCACTGCAGGCTGG + Intronic
1019918257 7:4147244-4147266 GATCATAGGTCACCGCAGCCTGG + Intronic
1019982386 7:4631013-4631035 AATCATAGCTCACTGCAGCCCGG + Intergenic
1019985698 7:4654008-4654030 GATCATAGCTCACTGCAACCTGG + Intergenic
1020040887 7:5000006-5000028 GATCATAGCTCACTGCAGCCTGG - Intronic
1020088077 7:5322362-5322384 GATCATAGCTCACTGCAGCCTGG + Intronic
1020235914 7:6355399-6355421 GATGCTACTGCACTCCAGCCTGG - Intergenic
1020420548 7:7999539-7999561 GATCGTAGCTCACTGCAGCCTGG - Intronic
1020841715 7:13225851-13225873 GATCACAGCTCACTGCAGCCTGG - Intergenic
1020943802 7:14575057-14575079 AATCATAGCTCACTGCAGCCTGG - Intronic
1021126303 7:16854086-16854108 CACCATACTGCACTCCAGCCTGG - Intergenic
1021391963 7:20103640-20103662 GATCATAGTTCACCATAACCTGG - Intergenic
1021505458 7:21379195-21379217 GATCATAGCTCACTGTAGCCTGG - Intergenic
1021699580 7:23304563-23304585 GGTCATAGCTCACTGCAGCCTGG + Intronic
1021779866 7:24093304-24093326 GATGCTACTGCACTCCAGCCTGG - Intergenic
1021801804 7:24314829-24314851 CATCATAGTTCACTGTAGCCTGG - Intergenic
1021983634 7:26078596-26078618 GATCACAGATCACTGCAGCCTGG - Intergenic
1022084683 7:27055725-27055747 GATCATAGCTCACTGCAGCCTGG + Intergenic
1022350166 7:29560795-29560817 AATCATAGCTCACTGCAGCCTGG + Intergenic
1022354812 7:29603776-29603798 AATCATAGCTCACTGCAGCCTGG + Intergenic
1022726835 7:32988792-32988814 GATCATCGTGTACTATGGCCTGG + Intronic
1022813862 7:33895204-33895226 AATCATAGCTCACTGCAGCCTGG - Intergenic
1023011240 7:35926375-35926397 AATCATAGATCACTGCAGCCTGG + Intergenic
1023124198 7:36938960-36938982 GATTATAGCTCACTGCAGCCTGG - Intronic
1023318187 7:38963467-38963489 GATCATAGCTCACTGCAGCCTGG - Intergenic
1023449869 7:40272236-40272258 GATCATAGCTCATTCCAGCCTGG + Intronic
1023557808 7:41441450-41441472 CATCATAGCTCACTGCAGCCTGG - Intergenic
1023605416 7:41926865-41926887 GATCACAGCTCACTACAGCCTGG + Intergenic
1023801731 7:43840687-43840709 CATCATAGCTCACTGCAGCCTGG + Intergenic
1023827276 7:44018132-44018154 GATCAAAGCTCACTGCAGCCTGG + Intergenic
1023978074 7:45047469-45047491 GATCATGGCTCACTGCAGCCTGG - Intronic
1024079906 7:45847529-45847551 AATCATAGATCACTGCAGCCTGG - Intergenic
1024083370 7:45873964-45873986 GATCACATTGCACTCTAGCCTGG - Intergenic
1024152599 7:46588051-46588073 CATGATACTGCACTCCAGCCTGG + Intergenic
1024213346 7:47226356-47226378 AATCATAGTTCACTGCAGCCTGG + Intergenic
1024460873 7:49658144-49658166 GATCATAGCTCATTACAGCCTGG - Intergenic
1024762880 7:52621383-52621405 GATCATAGCTCACTGCAGCTTGG - Intergenic
1024897977 7:54282061-54282083 AATCATAGCTCACTGCAGCCTGG + Intergenic
1025109563 7:56202612-56202634 GATCATAGCTCTCTGCAGCCTGG - Intergenic
1025110854 7:56214986-56215008 GATCATAGCTCATTGCAGCCTGG - Intergenic
1025116074 7:56259517-56259539 GATCATAGCTCATTGCAGCCTGG + Intergenic
1025124874 7:56336467-56336489 AATCATAGATCACTGCAGCCTGG + Intergenic
1025191933 7:56902224-56902246 GATCATAGCTCACTGTAGCCTGG - Intergenic
1025680017 7:63674707-63674729 GATCATAGCTCACTGTAGCCTGG + Intergenic
1025729107 7:64094240-64094262 GATGCCAGTGCACTCCAGCCTGG + Intronic
1026006074 7:66601358-66601380 CATGACAGTGCACTCCAGCCAGG - Intergenic
1026018051 7:66686404-66686426 GATCACAGCTCACTGCAGCCTGG - Intronic
1026026225 7:66745892-66745914 GATCACAGCTCACTGCAGCCTGG - Intronic
1026034432 7:66820856-66820878 CATCATAGCTCACTGCAGCCTGG + Intergenic
1026088898 7:67283927-67283949 GGTCATAGTGTATTTCAGCCGGG + Intergenic
1026114583 7:67485567-67485589 GATCACAGCTCACTGCAGCCTGG + Intergenic
1026150376 7:67783301-67783323 GATCATGGCTCACTACAACCTGG - Intergenic
1026181658 7:68046657-68046679 GATCATAGCTCACTGTAGCCTGG - Intergenic
1026196035 7:68174685-68174707 GATCATACCTCACTGCAGCCTGG + Intergenic
1026260415 7:68750263-68750285 AATCATAGTTCACTGCAGCCTGG + Intergenic
1026287151 7:68973369-68973391 GATCATGGCTCACTGCAGCCTGG + Intergenic
1026307057 7:69151442-69151464 GATCATAGCTCACTGCAGCTTGG + Intergenic
1026483672 7:70799684-70799706 TATCCCAGTGCACTCCAGCCTGG - Intergenic
1026564453 7:71478377-71478399 GATCATGGCTCACTGCAGCCTGG + Intronic
1026588393 7:71676447-71676469 AATCATAGCTCACTGCAGCCTGG + Intronic
1026600835 7:71776016-71776038 GATCATAGCTCACTACAGCCTGG + Intergenic
1026627148 7:72005392-72005414 GATCACGGCTCACTACAGCCTGG + Intronic
1026725356 7:72866420-72866442 GGTCATAGTGTATTTCAGCCGGG - Intergenic
1026759362 7:73114948-73114970 GAGCCCAGTGCACTCCAGCCTGG - Intergenic
1026778388 7:73246622-73246644 GATCATAGCTCACTGCAGCCTGG - Intergenic
1026852451 7:73733614-73733636 GATCTCACTGCACTCCAGCCTGG + Intergenic
1026939474 7:74278897-74278919 GATCATAGCTCACTGCAGCCTGG - Intergenic
1026945043 7:74310455-74310477 AATCATGGTTCACTGCAGCCTGG - Intronic
1026985227 7:74550973-74550995 CATCATAGCTCACTGCAGCCTGG - Intronic
1026994793 7:74608445-74608467 GATCATAGCTCACTGAAGCCTGG + Intergenic
1027019245 7:74800016-74800038 GATCATAGCTCACTGCAGCCTGG - Intronic
1027025216 7:74847034-74847056 GATCATAGCTCCCTGCAGCCTGG + Intronic
1027062547 7:75097085-75097107 GATCATAGCTCCCTGCAGCCTGG - Intronic
1027068783 7:75145922-75145944 GATCATAGCTCACTGCAGCCTGG + Intronic
1027088047 7:75278525-75278547 GAGCCCAGTGCACTCCAGCCTGG + Intergenic
1027204707 7:76088576-76088598 GATCCCACTGCACTCCAGCCTGG + Intergenic
1027216091 7:76185026-76185048 AATCATAGCTCACTGCAGCCTGG + Intergenic
1027247833 7:76379427-76379449 GACAATACTGCACTTCAGCCTGG - Intergenic
1027349072 7:77292226-77292248 GATCATAGCTTACTGCAGCCTGG - Intronic
1027367656 7:77474761-77474783 GATCAGAAAGCACTTCAGCCTGG + Intergenic
1027564729 7:79777004-79777026 GATCACAGCTCACTGCAGCCTGG - Intergenic
1027796325 7:82698210-82698232 GATCATACCTCACTGCAGCCTGG - Intergenic
1027847266 7:83397035-83397057 CATGACACTGCACTACAGCCTGG + Intronic
1027909965 7:84238111-84238133 GATCACACTGCACTCCAGTCTGG - Intronic
1027975100 7:85143763-85143785 CATGCTACTGCACTACAGCCTGG - Intronic
1028328115 7:89551923-89551945 GGTCATAGCGCACTGCAGCATGG - Intergenic
1028593094 7:92519288-92519310 AATCATAGTTCACTGCAGCCTGG + Intronic
1028882127 7:95892009-95892031 GATGCTACTGCACTCCAGCCTGG - Intronic
1028883767 7:95909443-95909465 GACTACATTGCACTACAGCCGGG + Intronic
1028962386 7:96763310-96763332 GATCACAGAGCACTACAGCCTGG + Intergenic
1028982782 7:96984959-96984981 GACTGTAGTGCACTCCAGCCTGG - Intergenic
1029081008 7:97973802-97973824 GATCATAGCTCACTGCAGCCTGG + Intergenic
1029102227 7:98140989-98141011 GATCATGGCTCACTGCAGCCTGG - Intronic
1029170028 7:98624024-98624046 AATCATAGCTCACTGCAGCCTGG + Intronic
1029199330 7:98828095-98828117 GATCATAGCTCACTACAGCCTGG + Intergenic
1029237744 7:99136121-99136143 GATCATAGCTCACTGCAGCCTGG - Intronic
1029264075 7:99325087-99325109 GATCATAGCTAACTGCAGCCTGG - Intergenic
1029394156 7:100295658-100295680 GAGCCCAGTGCACTCCAGCCTGG + Intergenic
1029422943 7:100480711-100480733 GATCATAGCTCACCACAGCCTGG + Intergenic
1029429574 7:100521950-100521972 AATCATGGTTCACTACAGCCTGG - Intergenic
1029449421 7:100632613-100632635 GATCATAGCTCACTGCAGCCTGG + Intronic
1029477377 7:100792913-100792935 GGTCATGGTTCACTGCAGCCTGG - Intronic
1029508293 7:100976210-100976232 GATCCTAGCTCACTGCAGCCTGG - Intronic
1029555437 7:101265665-101265687 AATCATAGCTCACTGCAGCCTGG + Intergenic
1029661368 7:101964307-101964329 CATGACAGTGCACTCCAGCCTGG + Intronic
1029672954 7:102046640-102046662 GATCACAGCTCACTGCAGCCTGG + Intronic
1029680708 7:102107166-102107188 GATCATAGCTCACTGCAGCCTGG - Intronic
1029738433 7:102477878-102477900 GATCAAAGCTCACTGCAGCCTGG + Intronic
1029755563 7:102571536-102571558 GATCAAAGCTCACTGCAGCCTGG + Intronic
1029773512 7:102670616-102670638 GATCAAAGCTCACTGCAGCCTGG + Intronic
1029999501 7:105044030-105044052 GATCATGGCTCACTGCAGCCTGG - Intronic
1030051569 7:105542267-105542289 CATCATAGCTCACTGCAGCCTGG - Intronic
1030641829 7:112014837-112014859 GATCATAGCTCACTGCAGCCTGG - Intronic
1030644749 7:112047756-112047778 GATTATAGCTCACCACAGCCTGG + Intronic
1031405309 7:121378383-121378405 GATCACAGCTCACCACAGCCTGG + Intronic
1031533961 7:122910793-122910815 AATCATAGCTCACTGCAGCCTGG - Intergenic
1031701461 7:124931374-124931396 GATCATAGCTCGCTGCAGCCTGG + Intergenic
1031800488 7:126237582-126237604 GATCATAGCTCACTGCAGCCTGG - Intergenic
1031844299 7:126785762-126785784 GAGCCTAGGTCACTACAGCCTGG + Intronic
1031876044 7:127142046-127142068 GATCATAGCTCACTACAACCTGG + Intronic
1032100110 7:128968774-128968796 GATCATAGCTCACTGCAGGCTGG + Intronic
1032229731 7:130064304-130064326 GATCATAGCTCACTGCAGCCTGG + Intergenic
1032338895 7:131052850-131052872 TATCCTATTGCACTTCAGCCTGG - Intergenic
1032613988 7:133445970-133445992 TATAATACTGCACTTCAGCCTGG + Intronic
1032814246 7:135455206-135455228 GATCCTAGGTCACTGCAGCCTGG - Intronic
1033078476 7:138271656-138271678 AATCATAGCTCACTGCAGCCAGG + Intergenic
1033240364 7:139674020-139674042 GAGCCTACTGCACTTCAGCCCGG + Intronic
1033307214 7:140233755-140233777 AATCATAGCTCACTACAGCCAGG + Intergenic
1033316996 7:140305681-140305703 GATCACAGCTCACTGCAGCCTGG + Intronic
1033879009 7:145858396-145858418 AATCATAGCTCACTGCAGCCTGG - Intergenic
1034130773 7:148714949-148714971 GATCACAGTCCACAGCAGCCTGG + Intronic
1034218441 7:149425554-149425576 CATCATGGCTCACTACAGCCTGG - Intergenic
1034263198 7:149769752-149769774 GATCATACCTCACTGCAGCCTGG + Intronic
1034289625 7:149919282-149919304 CATGATACTGCACTCCAGCCTGG - Intergenic
1034353826 7:150435074-150435096 GATCATAGTTTACTGTAGCCTGG + Intergenic
1034538560 7:151741145-151741167 GATCATGGCTCACTAGAGCCTGG - Intronic
1034661436 7:152773541-152773563 CATGATACTGCACTCCAGCCTGG + Intronic
1035139822 7:156748530-156748552 CATGCCAGTGCACTACAGCCTGG - Intronic
1036080661 8:5552125-5552147 GATCGTAGTGCACTACAGCCTGG + Intergenic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1036556910 8:9868217-9868239 GATCATAGCTCACTACAGCCTGG + Intergenic
1036557304 8:9871536-9871558 GCTCATAGCTCACTGCAGCCTGG - Intergenic
1036923473 8:12880765-12880787 AATCATAGGTCACTGCAGCCTGG - Intergenic
1037026441 8:14044013-14044035 CATCCTACTGCACTCCAGCCTGG - Intergenic
1037109192 8:15145530-15145552 CATCATAGCTCACTGCAGCCTGG + Intronic
1037440482 8:18911040-18911062 GATCATAGTTTACTGCAGCCAGG - Intronic
1037519371 8:19665055-19665077 CATCTCAGTGCACTCCAGCCTGG - Intronic
1037968694 8:23155310-23155332 GATCATAGTCTACTACAGCCTGG + Intronic
1038066498 8:23968756-23968778 GATCATAGTTCACTGCATCCTGG + Intergenic
1038077835 8:24097589-24097611 AATCATAGAGCACTACAGGGAGG - Intergenic
1038111471 8:24504300-24504322 GATCATAGCTCACTGCAGTCTGG - Intronic
1038148611 8:24921776-24921798 GATCATGGTTCACTGCAGCCTGG + Intergenic
1038385725 8:27142683-27142705 GATGCCATTGCACTACAGCCTGG + Intergenic
1038646928 8:29369744-29369766 CATCATAGTTCACTGTAGCCTGG - Intergenic
1038721317 8:30038503-30038525 GATCATGGCTCACTATAGCCCGG - Intergenic
1038942607 8:32322110-32322132 GATCACTGTGCACTACAGACTGG - Intronic
1038954271 8:32450336-32450358 AACCATTGTGAACTACAGCCTGG - Intronic
1038965013 8:32562311-32562333 GATCATAGCTCACTGTAGCCTGG + Intronic
1039044834 8:33440294-33440316 GATCATAGCTCACTGCAGGCTGG - Intronic
1039132965 8:34288336-34288358 GACCATAGCTCACTGCAGCCTGG - Intergenic
1039311810 8:36324441-36324463 GATCATAGCTCACTGCAGCCTGG - Intergenic
1039405868 8:37312083-37312105 GATCACACTGCACTCCAGCCTGG - Intergenic
1039477224 8:37845734-37845756 CATCATAGCTCACTGCAGCCTGG - Intronic
1039491552 8:37951507-37951529 GATTACACTGCACTCCAGCCTGG + Intergenic
1039529066 8:38243691-38243713 GATCACAGCTCACTGCAGCCTGG + Intronic
1039563578 8:38532310-38532332 AATCATAGCTCACTGCAGCCTGG - Intergenic
1039618096 8:38973001-38973023 GATCATGGCTCACTGCAGCCTGG + Exonic
1039881601 8:41628700-41628722 GTTCATGGCTCACTACAGCCTGG + Intergenic
1039897185 8:41724899-41724921 CATCACACTGCACTCCAGCCTGG - Intronic
1039916327 8:41862944-41862966 GATCATGGCTCACTGCAGCCTGG - Intronic
1039937055 8:42053843-42053865 GATCATAGTTCACTGCAGCCTGG - Intergenic
1040012330 8:42672497-42672519 GATCATAGCTTACTGCAGCCTGG + Intergenic
1040424908 8:47275920-47275942 GATCACAGCTCACTGCAGCCTGG + Intronic
1041218941 8:55629967-55629989 GATCTTAGCTCACTGCAGCCTGG - Intergenic
1041679160 8:60569574-60569596 GATCATGGCTCACTGCAGCCTGG + Intronic
1041680556 8:60585376-60585398 GATCATAGCTCACTGCAGCTTGG + Intronic
1041684855 8:60634050-60634072 GATCATAGCTCACTACAGTCTGG - Intergenic
1041790098 8:61685830-61685852 CATGCTAGTGCACTACAGCCTGG - Intronic
1041864854 8:62560581-62560603 GATGCCATTGCACTACAGCCTGG - Intronic
1042229353 8:66541112-66541134 GATCATAGCTCACTGCAGCCTGG + Intergenic
1042323453 8:67503338-67503360 GATGCTACTGCACTCCAGCCTGG - Intronic
1042438658 8:68798360-68798382 GATCACAGCTCACTGCAGCCTGG + Intronic
1042490683 8:69394077-69394099 GATCATAGGGCACTGCAGGCAGG + Intergenic
1042511506 8:69617205-69617227 CATGCTACTGCACTACAGCCTGG - Intronic
1042553396 8:70014059-70014081 GATCGCACTGCACTCCAGCCTGG + Intergenic
1042746167 8:72108936-72108958 GATCATAGCTCATTGCAGCCTGG - Intronic
1042825126 8:72972227-72972249 GGTGATACTGCACTCCAGCCTGG + Intergenic
1043229352 8:77781317-77781339 AATCATAGCCCACTGCAGCCTGG + Intergenic
1043354832 8:79400322-79400344 GATCGCACTGCACTCCAGCCTGG + Intergenic
1043530296 8:81142611-81142633 TATGATACTGCACTTCAGCCTGG - Intergenic
1044498113 8:92915525-92915547 CATGTTACTGCACTACAGCCTGG - Intronic
1045230398 8:100300585-100300607 GATCATAGCTCACTGCAGCCTGG - Exonic
1045323850 8:101102233-101102255 AATCACAGCTCACTACAGCCTGG + Intergenic
1045750066 8:105472959-105472981 GATCATAGCTCACTACAGCCTGG + Intronic
1046772075 8:118126282-118126304 GATCACAGCTCACTGCAGCCTGG - Intergenic
1047123850 8:121938100-121938122 CATGACAGTGCACTCCAGCCTGG - Intergenic
1047297286 8:123582134-123582156 CATGCTAGTGCACTCCAGCCCGG + Intergenic
1047368077 8:124230787-124230809 GATTGTACTGCACTCCAGCCTGG - Intergenic
1047400802 8:124545592-124545614 GATCATAGCTCACTGCAGCCTGG + Intronic
1047452673 8:124979824-124979846 GGTGCTAGTGCACTACAGTCTGG - Intergenic
1047595523 8:126374201-126374223 AATCATAGCTCACTGCAGCCTGG + Intergenic
1047704708 8:127486183-127486205 GATTACAGTGCACTGCAGCCTGG - Intergenic
1047814547 8:128448513-128448535 GATCATAGAGAACCACAGCTAGG - Intergenic
1048061120 8:130920075-130920097 AATCATAGCTCACTGCAGCCTGG - Intronic
1048578404 8:135710790-135710812 GATCACAGATCACCACAGCCTGG + Intergenic
1049088388 8:140495218-140495240 AATCATAGCTCACTGCAGCCTGG + Intergenic
1049090410 8:140510349-140510371 GATCGCACTGCACTCCAGCCTGG + Intergenic
1049107092 8:140620977-140620999 GATCACAGCTCACTGCAGCCTGG + Intronic
1049738655 8:144223439-144223461 GATCATAGCACACTGCAGCCTGG + Intronic
1049982981 9:921804-921826 GATCATAGCTCACTGCAGCCTGG - Intronic
1050370257 9:4914258-4914280 GTTCATAGCTCACTTCAGCCTGG + Intergenic
1050457416 9:5847298-5847320 GAGCAGACTGCACTACAGCCTGG - Intergenic
1050572938 9:6960343-6960365 AATCATAGCTCACTGCAGCCTGG + Intronic
1050912665 9:11092547-11092569 GATTATAGTGCACTGTAGTCCGG - Intergenic
1050998245 9:12246700-12246722 GATCATAGCTCATTGCAGCCTGG + Intergenic
1051081495 9:13299640-13299662 GATCATAGCTCACTGCAGCCTGG + Intergenic
1051216099 9:14799218-14799240 AATCACAGTTCACTCCAGCCTGG - Intronic
1051274068 9:15382105-15382127 GATCATAGCTCACTGTAGCCTGG - Intergenic
1051288928 9:15525984-15526006 CAGCATAGTGCACTATAGCCTGG + Intergenic
1051294071 9:15576247-15576269 GATCATTGCTCCCTACAGCCTGG + Intronic
1051390755 9:16560660-16560682 GATCATAGCTCACTGCAGCCTGG - Intronic
1051432905 9:16998743-16998765 GATCATAGCTCACTCCAGCCTGG + Intergenic
1051666771 9:19473330-19473352 CACCATATTGCACTCCAGCCTGG - Intergenic
1051932487 9:22402930-22402952 GATCATGGCTCACTGCAGCCTGG - Intergenic
1052181427 9:25533547-25533569 GATGACACTGCACTCCAGCCTGG - Intergenic
1052196663 9:25725002-25725024 AATCATAGCTCACTGCAGCCTGG - Intergenic
1052287552 9:26803591-26803613 GATCACACTGCACTCCAGCCTGG + Intergenic
1052616352 9:30846780-30846802 GATCAAAGAGCACTAAACCCTGG - Intergenic
1052647234 9:31252665-31252687 GATCATAGCTCACTGTAGCCTGG - Intergenic
1052910266 9:33874735-33874757 GATCATAGCTCACTGCAGCCTGG + Intronic
1052925844 9:34015740-34015762 GATGCTACTGCACTCCAGCCTGG - Intronic
1052958174 9:34271027-34271049 GATCATAGTTTACTACAGCCTGG - Intronic
1052964278 9:34327789-34327811 CATGCTAGTGCACTACAGCCTGG + Intronic
1053088787 9:35253205-35253227 AATCATAGCTCACTACATCCTGG + Intronic
1053213459 9:36251487-36251509 GATCATAGCTCATTGCAGCCTGG + Intronic
1053318200 9:37070956-37070978 GATCATAGCTTACTGCAGCCTGG + Intergenic
1053408659 9:37900509-37900531 GATCATGGCTCACTGCAGCCTGG + Intronic
1053640930 9:40079316-40079338 GAGCACACTGCACTTCAGCCTGG - Intergenic
1053765208 9:41386152-41386174 GAGCACACTGCACTTCAGCCTGG + Intergenic
1053801309 9:41766114-41766136 GATCATAGCTCACTGCAGCCTGG - Intergenic
1053861481 9:42390711-42390733 GATGCCACTGCACTACAGCCTGG - Intergenic
1054143892 9:61548709-61548731 GATCATAGCTCACTGCAGCCTGG + Intergenic
1054173653 9:61860695-61860717 GATCATTCTGCACTGCAGCGAGG - Intergenic
1054189739 9:61978268-61978290 GATCATAGCTCACTGCAGCCTGG - Intergenic
1054321618 9:63675297-63675319 GAGCACACTGCACTTCAGCCTGG - Intergenic
1054463670 9:65480048-65480070 GATCATAGCTCACTGCAGCCTGG + Intergenic
1054543822 9:66297314-66297336 GAGCACACTGCACTTCAGCCTGG + Intergenic
1054648776 9:67610324-67610346 GATCATAGCTCACTGCAGCCTGG + Intergenic
1054663887 9:67720086-67720108 GATCATTCTGCACTGCAGCGAGG + Intergenic
1055053552 9:72003014-72003036 GATCATAACTCACTGCAGCCTGG + Intergenic
1055188482 9:73487337-73487359 AATCATAGCTCACTGCAGCCTGG - Intergenic
1056220743 9:84448764-84448786 AATCATAGAGAACTACAGCCTGG + Intergenic
1056220801 9:84449300-84449322 AATCATAGAGAACTACAGCCTGG + Intergenic
1056375401 9:86004411-86004433 GATCACAGCTCACTGCAGCCTGG - Intronic
1056519499 9:87387101-87387123 GATCATAGTACACTACAGCCTGG - Intergenic
1056539341 9:87557895-87557917 GATGACATTGCACTCCAGCCTGG + Intronic
1056628273 9:88272115-88272137 GGTGCTGGTGCACTACAGCCTGG + Intergenic
1056939997 9:90946857-90946879 GATCATAGCTCACTGCAGCCTGG - Intergenic
1057103478 9:92387805-92387827 CATGACACTGCACTACAGCCTGG - Intronic
1057165624 9:92923235-92923257 AATCATAGTTCACGGCAGCCTGG + Intergenic
1057424913 9:94940548-94940570 GCTCAGACTGCACTCCAGCCTGG + Intronic
1057633906 9:96745198-96745220 GATCATGGCTCACTGCAGCCTGG + Intergenic
1057741167 9:97712432-97712454 GATCACAGCTCACTGCAGCCTGG - Intergenic
1057757681 9:97851150-97851172 AATGATTGTGCACTACAGCCTGG + Intergenic
1057848323 9:98543428-98543450 TATCATAGCTCACTGCAGCCTGG + Intronic
1057849369 9:98552940-98552962 GATCATAGCTCACTGCAGCCCGG + Intronic
1057864044 9:98665201-98665223 GATCATGGTTCACTGCAGCCTGG - Intronic
1058277565 9:103064115-103064137 GATGCCACTGCACTACAGCCTGG + Intergenic
1058278785 9:103084776-103084798 GATCATAGCTCTCTACAGCCTGG + Intergenic
1058404042 9:104651520-104651542 GATCATATCTCACTGCAGCCTGG - Intergenic
1058812860 9:108658215-108658237 GATCATGGTTCACTGCAGCCTGG + Intergenic
1059266803 9:113040994-113041016 GGTTACAGTGCACTCCAGCCTGG - Intronic
1060102608 9:120853760-120853782 CATGCTACTGCACTACAGCCTGG + Intergenic
1060107487 9:120882544-120882566 TATGAAAGTGCTCTACAGCCAGG + Intronic
1060181350 9:121536626-121536648 GATCATGGTTCACTGCAGCCAGG + Intergenic
1060595770 9:124847774-124847796 GATCACAGCTCACTGCAGCCTGG + Intergenic
1060614611 9:125000534-125000556 GATCATAGTTCACTGCAGCCTGG - Intronic
1060953492 9:127620714-127620736 CATCCTACTGCACTCCAGCCTGG + Intronic
1061021458 9:128018199-128018221 GATCATGGCTCACTGCAGCCTGG - Intergenic
1061066111 9:128278518-128278540 GATCACCCTGCACTCCAGCCTGG + Intronic
1061332921 9:129908267-129908289 GATCATAGCTCACTGCAGCCAGG + Intronic
1061364142 9:130162253-130162275 GATTATACTGCGCTATAGCCTGG + Intergenic
1061469356 9:130811221-130811243 GATCATAGCTCACTGCAGCCTGG - Intronic
1061598873 9:131652314-131652336 GATCACAGCTCACCACAGCCTGG + Intronic
1061635324 9:131904464-131904486 GATCATAGCTCACTGCAGCCTGG + Intronic
1061851154 9:133416534-133416556 GATCATAGCTCACTGCTGCCTGG - Intronic
1062239671 9:135529606-135529628 AATCATAGCTCACTACAGCCTGG + Intergenic
1202788703 9_KI270719v1_random:62391-62413 GAGCACACTGCACTTCAGCCTGG - Intergenic
1185474875 X:409134-409156 CATGATATTGCACTCCAGCCTGG - Intergenic
1185570916 X:1134118-1134140 CACCATATTGCACTCCAGCCTGG + Intergenic
1185597926 X:1319335-1319357 CATGATCGTGCACTCCAGCCTGG - Intergenic
1185822889 X:3221636-3221658 GATCATAGCTCACTGCAGCCTGG - Intergenic
1185889740 X:3813740-3813762 GATCATAGCTCACTGCATCCTGG + Intergenic
1185962391 X:4558996-4559018 GATCACACTGCACTCCAGCTTGG + Intergenic
1186016442 X:5200248-5200270 GATCATAGCTCACTGCAGCCTGG + Intergenic
1186031424 X:5373326-5373348 GATCAGAGCTCACTGCAGCCTGG - Intergenic
1186034103 X:5402479-5402501 GATCATAGCTCACTGCAGCCTGG + Intergenic
1186171009 X:6877033-6877055 GATCATAGGTCACTGTAGCCTGG + Intergenic
1186261195 X:7781720-7781742 GATAATAGCTCACTGCAGCCTGG + Intergenic
1186326428 X:8482274-8482296 AATCATAGGTCACTGCAGCCTGG + Intergenic
1186400727 X:9257151-9257173 GATCATAGCTCACTGAAGCCTGG + Intergenic
1186403883 X:9284441-9284463 GATCACAGCTCACTGCAGCCTGG - Intergenic
1186473846 X:9841991-9842013 CATCATAGTTCACTACAGCCTGG - Intronic
1186485504 X:9931598-9931620 GATCACACTGTACTCCAGCCTGG + Intronic
1186489786 X:9962505-9962527 GATCTCACTGCACTCCAGCCTGG - Intergenic
1186654592 X:11599012-11599034 CATGATACTGCACTCCAGCCTGG + Intronic
1186770192 X:12810782-12810804 GATCATAGCTCTCTGCAGCCTGG - Intronic
1186826722 X:13347547-13347569 GATCACAGCTCACTGCAGCCTGG + Intergenic
1186845378 X:13525510-13525532 GACCATAGTTCCCTACAGACGGG - Intergenic
1187066102 X:15839544-15839566 GATCATGGCTCACTATAGCCTGG + Intronic
1187318884 X:18222902-18222924 AATCATGGTTCACTGCAGCCTGG + Intergenic
1187609662 X:20928380-20928402 GAGCATAGAGCACTCCAGGCGGG - Intergenic
1187883442 X:23866721-23866743 GATCATAGCTCATTGCAGCCTGG - Intronic
1187952572 X:24485466-24485488 GAGCATAGTGCAGCAGAGCCCGG + Intronic
1187957584 X:24534889-24534911 AATCATAGCTCACTACAGCCTGG - Intronic
1188226172 X:27601001-27601023 GATCATAGCTCACTGCAGCCTGG + Intronic
1188235141 X:27719489-27719511 GATCGCACTGCACTCCAGCCTGG - Intronic
1188790876 X:34406852-34406874 GATCACAGCTCACTGCAGCCAGG + Intergenic
1188907661 X:35807710-35807732 TATCACACTGCACTCCAGCCTGG + Intergenic
1189063897 X:37785608-37785630 GATCATAGCTCACTGCAGCCTGG + Intronic
1189068173 X:37834258-37834280 GATCACAGCTCACTGCAGCCTGG + Intronic
1189307274 X:39996287-39996309 GATCACAGCTCACTGCAGCCTGG - Intergenic
1189348027 X:40257221-40257243 GATCATAGCTCACTGCAACCTGG + Intergenic
1189405822 X:40721613-40721635 GATCATAGAGCCCTAGGGCCTGG + Intronic
1189436330 X:40996223-40996245 GATCACAGCTCACTGCAGCCTGG + Intergenic
1189472625 X:41325988-41326010 GATCATAGCTCATTGCAGCCTGG - Intergenic
1189536356 X:41939169-41939191 CATCCCACTGCACTACAGCCTGG - Intergenic
1189768257 X:44394323-44394345 GATCATAGCTCACTGCAGCCTGG - Intergenic
1189998798 X:46664815-46664837 GATTATAGTTCACTATAGCCTGG + Intronic
1190011041 X:46784902-46784924 GATCACAGATCACTGCAGCCTGG - Intergenic
1190018171 X:46846787-46846809 GATCATGGCTCACTGCAGCCTGG + Intronic
1190034304 X:47006347-47006369 GATCACAGCTCACTACAGCCTGG + Intronic
1190081585 X:47360815-47360837 AATCATAGCTCACTGCAGCCTGG + Intergenic
1190405027 X:50078266-50078288 TATCATTGCTCACTACAGCCTGG - Intronic
1190473969 X:50810040-50810062 AATCATGGTACACTGCAGCCTGG + Intronic
1190515001 X:51214685-51214707 GATCACACTGCACTCCAGTCTGG + Intergenic
1192049419 X:67710384-67710406 AATCATAGCCCACTGCAGCCTGG + Intronic
1192069312 X:67919745-67919767 CATCCGAGTGCACTCCAGCCTGG + Intergenic
1192461075 X:71318135-71318157 CATGCTAGTGCACTCCAGCCTGG - Intergenic
1193115886 X:77774773-77774795 GATCATAGTTCATGGCAGCCTGG + Intronic
1193138548 X:78000706-78000728 GGTCCTACTGCACTCCAGCCTGG - Intronic
1193332315 X:80248751-80248773 GATAATAGTGCACTCCATTCAGG + Intergenic
1194069950 X:89310366-89310388 GATGCCAGTGCACTTCAGCCTGG - Intergenic
1194077887 X:89419389-89419411 GATCATATTTCACTGCAGCCTGG + Intergenic
1194314859 X:92364824-92364846 CTTTTTAGTGCACTACAGCCCGG - Intronic
1195256997 X:103100840-103100862 GGTGATAGTACGCTACAGCCTGG - Intergenic
1195590672 X:106621986-106622008 GATCATGGTTCACTGCAGCCTGG + Intronic
1195699968 X:107697378-107697400 GATTATGGTTCACTGCAGCCTGG - Intergenic
1195939461 X:110155968-110155990 AATCATAGCTCACTGCAGCCTGG + Intronic
1196090687 X:111738602-111738624 GATCATGGCTCACTGCAGCCTGG + Intronic
1196210724 X:112993093-112993115 GATCATAGCTCTCTGCAGCCTGG + Intergenic
1196272057 X:113723797-113723819 CATCATGGTTCACTACAGCCTGG - Intergenic
1196294999 X:113987126-113987148 GATCGCACTGCACTTCAGCCTGG - Intergenic
1196338717 X:114570073-114570095 AATCACAGTGCACTACAGCCTGG - Intergenic
1196363399 X:114894762-114894784 CATGATACTGCACTCCAGCCTGG - Intronic
1196648733 X:118147172-118147194 CATCATAGCTCACTGCAGCCTGG - Intergenic
1196649139 X:118151052-118151074 TATCATAGCGCACTGCAGCCTGG + Intergenic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic
1196760467 X:119196533-119196555 GATCATAGCTCACTGCATCCTGG + Intergenic
1196914219 X:120515163-120515185 GATCATAGCTCACTGCAGCCTGG - Intergenic
1197125476 X:122941185-122941207 GATCATTGCTCACTGCAGCCTGG + Intergenic
1197517215 X:127447933-127447955 GATCATGGCTCACTGCAGCCTGG - Intergenic
1197778119 X:130133692-130133714 GATCATGGCTCACCACAGCCTGG + Intronic
1198011337 X:132558268-132558290 GATCATGGCTCACTGCAGCCTGG - Intergenic
1198104325 X:133448080-133448102 GATCATAGCTCACTGAAGCCTGG + Intergenic
1198213701 X:134537648-134537670 AATCATGGCGCACTGCAGCCTGG + Intergenic
1198441594 X:136668590-136668612 GATTACACTGCACTCCAGCCTGG - Intronic
1198504592 X:137289158-137289180 GATCATAGCTCATTGCAGCCTGG + Intergenic
1198592301 X:138197798-138197820 GATCATAGCTCACTGCAGCCTGG + Intergenic
1199463287 X:148107915-148107937 TATCACATTGCACTCCAGCCTGG - Intergenic
1200090032 X:153630995-153631017 TATCCTACTGCACTCCAGCCTGG + Intergenic
1200428373 Y:3047117-3047139 GATCATAGCTCACTCCAGCCTGG + Intergenic
1200430537 Y:3074950-3074972 GATCATATTTCACTGCAGACTGG + Intergenic
1200622910 Y:5476341-5476363 CTTTTTAGTGCACTACAGCCTGG - Intronic
1200724190 Y:6646001-6646023 GATGCCAGTGCACTTCAGCCTGG - Intergenic
1201189392 Y:11433996-11434018 GATCACAGCACACTGCAGCCTGG + Intergenic
1201381348 Y:13383244-13383266 CATGCCAGTGCACTACAGCCTGG + Intronic
1201536916 Y:15059323-15059345 GATCACAGCTCACTGCAGCCTGG - Intergenic
1201738426 Y:17297213-17297235 GAACATAGCTCACTGCAGCCTGG - Intergenic