ID: 1155469099

View in Genome Browser
Species Human (GRCh38)
Location 18:26171934-26171956
Sequence CTGTGGGTCTTGAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155469099_1155469103 -7 Left 1155469099 18:26171934-26171956 CCCTTTATCCTCAAGACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1155469103 18:26171950-26171972 CCCACAGAGTTGATGTAATATGG 0: 1
1: 0
2: 1
3: 6
4: 112
1155469099_1155469107 21 Left 1155469099 18:26171934-26171956 CCCTTTATCCTCAAGACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1155469107 18:26171978-26172000 TTGAATGCTGTGAACAAAGTTGG 0: 1
1: 0
2: 2
3: 17
4: 254
1155469099_1155469105 -2 Left 1155469099 18:26171934-26171956 CCCTTTATCCTCAAGACCCACAG 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1155469105 18:26171955-26171977 AGAGTTGATGTAATATGGCCTGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155469099 Original CRISPR CTGTGGGTCTTGAGGATAAA GGG (reversed) Intronic
902502825 1:16922150-16922172 GTGTGCGTCTTGGGGATCAAGGG + Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
907476422 1:54708898-54708920 GTGTGGGGCTGGAGGATAATGGG + Intronic
909027149 1:70495114-70495136 CTGTGGGGCTTGAGTATGCAAGG - Intergenic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
915237948 1:154499559-154499581 CTGTGGCTTTAGAGCATAAAGGG + Intronic
916745642 1:167683027-167683049 CTGTGTGTCTTGGTGACAAATGG + Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919048113 1:192480043-192480065 CTGTGGGTCTCCAGGCTTAAGGG - Intergenic
919915256 1:202135026-202135048 CTGTGGCTCTTGGGTAGAAAAGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
1063025110 10:2170410-2170432 ATGGGGGTGGTGAGGATAAAAGG - Intergenic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1065171095 10:23030272-23030294 CTGTGGGTCTAGAGTATGCATGG - Intronic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1067824944 10:49564223-49564245 GATTGGGTCTTGAGGAGAAAGGG + Intergenic
1068051929 10:51961228-51961250 CTGTGGGACTTGAGCATGCATGG - Intronic
1070989042 10:80715325-80715347 CTGTGGGTCTTTATGATTTACGG + Intergenic
1075289918 10:121220204-121220226 CTGTGGGACTTGAGTATGCAGGG - Intergenic
1075623387 10:123944383-123944405 CTGTGGGTCTTTAAAACAAAGGG + Intergenic
1076542589 10:131223541-131223563 CTGTTGGTTTTGAAGTTAAAAGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077621444 11:3728340-3728362 CTTAGGGTTTTGAGGAGAAAAGG + Intronic
1079455787 11:20635152-20635174 CTGTGGGTGTTGATGATGTAGGG + Intronic
1079940876 11:26678844-26678866 CTGTGGGTCTTTAGGATGCATGG - Intronic
1080555011 11:33407869-33407891 ATGTGGGGGTTGAGGATGAAAGG - Intergenic
1081723126 11:45304521-45304543 CTCGGGGTTTTGTGGATAAATGG + Intergenic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1086070301 11:82792201-82792223 CTGTAAGTTTTGAGGATAATTGG - Intergenic
1086743209 11:90393208-90393230 CTGAGGGTTTTAAGCATAAAGGG - Intergenic
1091274120 11:134338558-134338580 AGGTGGGTCCTGAGGATGAAGGG - Intronic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1092424056 12:8359356-8359378 CTGTTGGTCCTGAGCATAAGAGG + Intergenic
1094530829 12:31273073-31273095 CTTTGGGCCTTGAGGCTAAGAGG + Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1102386795 12:112516752-112516774 CCTTGGGTCTTAAGGATATAAGG + Intergenic
1103037416 12:117667617-117667639 CTGTGGATCTTGAGGTTCAAGGG + Exonic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1106089517 13:26577341-26577363 CTGTTGGTGCTGAGCATAAAAGG - Intronic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1107661766 13:42646245-42646267 CTATGCTTCTTGAGGATAATTGG - Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108517039 13:51213216-51213238 CTTTGCCTCTGGAGGATAAAGGG - Intergenic
1108933414 13:55860180-55860202 CTGTGGGAGTTCAGGATTAAGGG + Intergenic
1110735133 13:78927770-78927792 CTGTGGGTCTTGGGCAGATAGGG - Intergenic
1114773835 14:25458673-25458695 CTGAGGGACTTGAGGATGCATGG - Intergenic
1115221192 14:31060299-31060321 CTGTGGGACTTGAGTATGCACGG + Intronic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1116406372 14:44571616-44571638 CTGAGGGTTTTAATGATAAAGGG - Intergenic
1116986687 14:51227472-51227494 CTGTGGGACTTGAGTATGCAAGG - Intergenic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1121300087 14:92863084-92863106 CTGTGAGGGGTGAGGATAAAAGG - Intergenic
1121475015 14:94191209-94191231 CTGTGGGGTGTGAGGAGAAAGGG + Intronic
1121483789 14:94298122-94298144 CTGTGGCTTTTCCGGATAAATGG + Intergenic
1121702286 14:95963641-95963663 CTGGGGGTCTTGTGGAAACATGG + Intergenic
1122537362 14:102474994-102475016 TTGTGGGCCTTGAGGATGAGGGG - Intronic
1126065947 15:44826534-44826556 CTGTTTGTTTTGATGATAAAAGG - Intergenic
1126093888 15:45074032-45074054 CTGTTTGTTTTGATGATAAAAGG + Exonic
1126405305 15:48316990-48317012 CTGCCGGTTTTGAAGATAAAGGG + Intergenic
1126541506 15:49829533-49829555 CAGTGAGTCTTGATGATAAAGGG + Intergenic
1126856030 15:52840280-52840302 CTGTGGGAGTTGAGGATCAGAGG + Intergenic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1127435992 15:58958720-58958742 CTGTGGGACTTGAGTATGTAAGG + Intronic
1129186438 15:73910118-73910140 ATGTGGGTAGTGAGGATAGATGG - Intergenic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1135004205 16:18803471-18803493 CTGTGGGTCTTTCGGGGAAAGGG + Intergenic
1135080553 16:19431119-19431141 CTGTGGGTCTTAAGTATGTAGGG + Intronic
1138510815 16:57507616-57507638 CTGTGGGGCTTGAGGAAGACTGG + Intergenic
1138615582 16:58163024-58163046 CTGTGTCTCATGGGGATAAAAGG + Intronic
1140042980 16:71421732-71421754 CAGAGGGTCTTGAGAATAACTGG + Intergenic
1141310491 16:82908973-82908995 CTGTGGGGCTTGAGTATGCATGG + Intronic
1141425000 16:83939169-83939191 CTGTGAGTCGGGAGGATGAAGGG + Intronic
1142001650 16:87667656-87667678 CTCTGGGCCTTGAAGATGAAGGG + Intronic
1203119888 16_KI270728v1_random:1527721-1527743 CTGGGGGTTTTGAGGAACAAGGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1146963526 17:37005241-37005263 CTGTGGGTCTGTACGACAAAAGG + Intronic
1147330555 17:39696546-39696568 CTGGGGCTCTTGAGGGTAATGGG + Intronic
1153130420 18:1850019-1850041 CTGTGAGTCCTAAGGCTAAATGG - Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156216869 18:35007967-35007989 CTGGGGGACTTGAGCATGAATGG + Intronic
1158706356 18:59795842-59795864 CTGTGGGCCTGGAGGGTAACTGG + Intergenic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1159687693 18:71443862-71443884 TTGTGGTTTTTGAAGATAAAAGG - Intergenic
1159930193 18:74304184-74304206 GTGTGGGTATTCTGGATAAAGGG + Intergenic
1161983764 19:7643400-7643422 GAGTGGGTCTTGTGGAGAAACGG + Intronic
1162563541 19:11432148-11432170 CTGTGGGACTTGAGTATGGAAGG - Intronic
1166044191 19:40219870-40219892 CTGTGCGACATGAGGATAGAAGG + Intergenic
1167622272 19:50566879-50566901 CTGGGGGTGTTGGGGAGAAAGGG + Intronic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
927029440 2:19105078-19105100 CTCTGGGTCCTGAGGAGACAGGG - Intergenic
927111127 2:19864401-19864423 CTTGGGGTCTTGAAGACAAATGG - Intergenic
927783341 2:25956014-25956036 CTGTGGCTCTTGATGATTTAGGG + Intronic
928473262 2:31596005-31596027 CTGAGGGTTTTAATGATAAAGGG - Intergenic
929289357 2:40171556-40171578 ATGTGGGTTTTGAGTAGAAAAGG + Intronic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
936771898 2:115923744-115923766 CTTTGGGTCCTCAGGAGAAAGGG - Intergenic
939366339 2:141237201-141237223 ATGTGGGTCATGGGGATAAAGGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
943167500 2:184349045-184349067 CTGAGGGTTTTGACGAAAAAAGG - Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
949012349 2:241687919-241687941 ATGTGGGTCATGATGATAATAGG + Intergenic
1169247938 20:4038507-4038529 CTGTGGGCAATGAGTATAAATGG + Intergenic
1169466814 20:5848857-5848879 CTGTGTGTCATTAGGATGAAGGG + Intronic
1170045070 20:12076310-12076332 CTGTGGGCCTTCATTATAAATGG + Intergenic
1170651148 20:18243198-18243220 CTGAGGGTTTTAATGATAAAGGG - Intergenic
1170778405 20:19401400-19401422 CTGTCAGTCTTGGGGATAAGAGG + Intronic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1171756748 20:29117503-29117525 CTGAGGGTTTTAAGCATAAAGGG + Intergenic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1176658180 21:9607273-9607295 CTCTGGGACTTGAGGAGAAGTGG - Intergenic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1179166507 21:38939308-38939330 CTGTGGATCTTTTAGATAAAGGG + Intergenic
1182623875 22:31632091-31632113 CTGTAGGGCTTGCGGAGAAATGG + Intronic
1185343755 22:50302601-50302623 CTGAGGGACTTCAGGAGAAAAGG - Intronic
949432095 3:3988224-3988246 CTGTGGCTCTTGGGCATTAAGGG - Intronic
951153417 3:19320349-19320371 CTGAGGGTCTTAATCATAAAGGG + Intronic
952790600 3:37197505-37197527 CTCTGGTTCTTTGGGATAAAAGG - Intergenic
953815574 3:46153546-46153568 CTGTGGGTCATGAGGAACAGGGG + Intergenic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
955943630 3:64170123-64170145 ATGTGGGTCTCCAGGAGAAAAGG - Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958592028 3:96170563-96170585 CTCTGGGACTTGAGTATATAAGG + Intergenic
959125600 3:102286834-102286856 CTGAGGGTTTTGATCATAAAGGG + Intronic
959826818 3:110807007-110807029 CTATGTGTCTTGGGGAGAAAAGG + Intergenic
959861651 3:111222829-111222851 CTGTGGGTCTTGATGTCCAAGGG + Intronic
960374437 3:116881141-116881163 CTGTGAATCTTGTGGAGAAAGGG - Intronic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964088318 3:152845202-152845224 CTGTGGGTATTGAAGTTAAGTGG + Intergenic
964359218 3:155877013-155877035 CTGTGAGTTTTGAGATTAAAAGG - Intronic
965468101 3:169057614-169057636 TTCTGGGTAATGAGGATAAATGG + Intergenic
966976998 3:185093620-185093642 CTGTGGGTATAGATGATACATGG + Intronic
967035440 3:185645702-185645724 CTCTGGGGCTTGGGGATGAAGGG + Intronic
970843539 4:20506679-20506701 TTTTGGGTCTTTAGAATAAAGGG - Intronic
971714255 4:30154867-30154889 CTTTAGGTTTTGAGGATAAAAGG + Intergenic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976536428 4:86223047-86223069 ATGTGGGTATTGAGGGTCAATGG - Intronic
977663193 4:99614923-99614945 ATGTGTGACTTGAGGATTAAGGG - Intronic
977829026 4:101568442-101568464 CTGAGGGTCTTAATCATAAAGGG - Intronic
978054406 4:104245656-104245678 CTGAGGGTTTTTAAGATAAAGGG + Intergenic
978127095 4:105147400-105147422 CTGAGGTTGTTCAGGATAAACGG - Intronic
979518789 4:121642273-121642295 CTGTGGGACTTGGGGAGCAAAGG - Intergenic
979580702 4:122355952-122355974 CTGTGGTTCTTGAACATGAATGG - Exonic
979779688 4:124635089-124635111 CAGTGAATCTTGAGGATTAATGG - Intergenic
981335750 4:143567325-143567347 CTGAGGGTTTTGATCATAAAGGG + Intergenic
982656216 4:158152801-158152823 CTGTGGGTTTTAATCATAAATGG - Intronic
982971310 4:161991688-161991710 CTGTGGGACTTGAGTATGCATGG + Intronic
985371733 4:189292350-189292372 CTGTGGGTGTGCAGAATAAAAGG + Intergenic
985417230 4:189748801-189748823 CTCTGGGACTTGAGGAGAAGTGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
992331402 5:75720574-75720596 ATGTGGGACCTGAGGATATAGGG + Intergenic
992582902 5:78200330-78200352 TTATGGTTTTTGAGGATAAAAGG + Intronic
994189674 5:96855788-96855810 CTGTTGGTCTTGTAGGTAAAAGG + Intronic
995472688 5:112519795-112519817 CTGAGGGTTTTAATGATAAAGGG + Intergenic
995672293 5:114619678-114619700 GTGTGGGACTAGGGGATAAATGG + Intergenic
995943447 5:117612866-117612888 CTGTGGGACTTGAGCATTATAGG - Intergenic
996086856 5:119313930-119313952 GTGTGGGTTTTGAGGTTAAAGGG + Intronic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
997798033 5:136830679-136830701 CTGAGGGTTTTGATCATAAAGGG + Intergenic
997876570 5:137553812-137553834 CTGAGGGTCTTAATCATAAAGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
999823379 5:155250737-155250759 CTCAGGGATTTGAGGATAAATGG + Intergenic
1000818027 5:165948046-165948068 CTGTGGGACTTGAGTATGAGTGG - Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1002825576 6:770356-770378 CTTTGGGGCTTGGGGAGAAAGGG + Intergenic
1004690625 6:17989205-17989227 CTGTGGGACTTGAGTATGCATGG + Intergenic
1006308572 6:33240682-33240704 CTGGGGGAGTTGAGGAGAAAAGG + Intergenic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1007893036 6:45314093-45314115 CTGAGGGTTTTGATCATAAAGGG - Intronic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008354336 6:50533594-50533616 CTTTAGATCTTGAGGATATAAGG + Intergenic
1008810709 6:55494207-55494229 GTTTAGGTCTTCAGGATAAAGGG - Intronic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1010407868 6:75525797-75525819 CTGTGTGTCTTGAGTATATGTGG - Intergenic
1011861959 6:91769474-91769496 CTGTGACTCTTCAGGATAACTGG + Intergenic
1012487175 6:99735315-99735337 ATCTGGGTCTAGAGGATAAAGGG + Intergenic
1012845328 6:104381179-104381201 CCCTGGGTCTTGAGGGTAAAGGG - Intergenic
1013248348 6:108310024-108310046 CCATGGGACTTGAGGAAAAAGGG - Intronic
1013417987 6:109941369-109941391 CTCAGGGTCCTGGGGATAAATGG - Intergenic
1014436533 6:121426820-121426842 CTTTGGTTCTTGATGATAAGTGG - Intergenic
1015018237 6:128440122-128440144 CTGTAGGACTTGAGTATACATGG + Intronic
1015203787 6:130612470-130612492 CAGTGTGTTGTGAGGATAAAGGG + Intergenic
1015340872 6:132099075-132099097 GTGTGAGTCTTGAATATAAATGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015900161 6:138056892-138056914 CTGAGGGTCTTAATCATAAAGGG - Intergenic
1016339111 6:143042096-143042118 CTATGGGTCTTCAAGAGAAAGGG - Intergenic
1018251016 6:161870330-161870352 CTGTGGGTCATGAAGAAAAGGGG + Intronic
1018257003 6:161930857-161930879 CTGTTGGCCATGAGGATGAAAGG + Intronic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1021415143 7:20375633-20375655 GTTTGGGTGTTGAAGATAAAGGG - Intronic
1027141460 7:75660823-75660845 CTGAGGGCTTTGAGGATGAAGGG - Intronic
1030980128 7:116176407-116176429 CCGTGGGGCTTAAGGATAAGCGG - Intergenic
1032803800 7:135336985-135337007 CTAGGGGTCTAGATGATAAAAGG + Intergenic
1032894984 7:136240616-136240638 CTGTGGCTCTTGAGGAGTAGTGG + Intergenic
1034036226 7:147825866-147825888 GTGTGGGTGTTGAAGATAGAAGG + Intronic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035652649 8:1280584-1280606 ATGTGTGTCTTGAGGAGTAAGGG + Intergenic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040492695 8:47939275-47939297 CTGTGGGACTTGAGTATGCATGG - Intronic
1044790382 8:95841082-95841104 CTGTGGCTCTTAAGGATGAAGGG - Intergenic
1045904633 8:107329687-107329709 CTGTGTGTCGTATGGATAAATGG + Intronic
1047176880 8:122549933-122549955 CTGTTGGGCTTTAGGCTAAAAGG + Intergenic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1049803252 8:144527780-144527802 CTGCGGGTCTGGGGGATGAAGGG + Exonic
1050988087 9:12108387-12108409 CTGAGGGTTTTGATGATAAAGGG - Intergenic
1053444307 9:38140030-38140052 CTGTGACTCTTGATGATAAAAGG - Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1057310265 9:93938566-93938588 CTGGGGGTCTTGAGCAGAAGGGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057576373 9:96245810-96245832 CTGTGGGTCCTGAGTCCAAAGGG - Intronic
1058058850 9:100474257-100474279 GTGGGGGTCGTGTGGATAAAGGG + Intronic
1058308088 9:103467913-103467935 CTGAGGGTTTTGATCATAAATGG + Intergenic
1059072850 9:111157252-111157274 CTGTGGGACTTGAGTATGCATGG - Intergenic
1059709288 9:116852698-116852720 TCATAGGTCTTGAGGATAAATGG - Intronic
1060916266 9:127392894-127392916 CAGGGGGTTTTGAGGATTAAAGG - Intronic
1061514906 9:131083420-131083442 CAGTTGGTGTTCAGGATAAAAGG + Intronic
1203635909 Un_KI270750v1:110848-110870 CTCTGGGACTTGAGGAGAAGTGG - Intergenic
1187082818 X:16009035-16009057 CTGTGGGACTTGAGCATCCATGG - Intergenic
1188772145 X:34165613-34165635 CTGAGGGTATTAAGAATAAATGG + Intergenic
1189698748 X:43694290-43694312 CTGTGGGTCCGGAGGCTACAGGG + Intronic
1189945696 X:46175756-46175778 CTGAGGGTCTTAACCATAAAGGG + Intergenic
1192766471 X:74145672-74145694 CTGAGGTTGTTTAGGATAAATGG + Intergenic
1192921252 X:75708738-75708760 CTGAGGGTTTTAATGATAAAGGG + Intergenic
1192991580 X:76464057-76464079 CTGTGGGTTTTAATCATAAAGGG + Intergenic
1193937445 X:87640640-87640662 CTGAGGGTTTTAATGATAAAGGG - Intronic
1195003413 X:100664333-100664355 GTGTGGGTGCTGGGGATAAATGG - Intronic
1195388971 X:104341284-104341306 ATGTGATTCTTGAGGATAGAGGG + Intergenic
1196212573 X:113011777-113011799 CTGTGAGACTTGAGTATACATGG - Intergenic
1196219212 X:113091847-113091869 CTGAGGGTTTTGATCATAAAGGG - Intergenic
1196656472 X:118223220-118223242 CTGTGGGACTTGAGTATGCAAGG - Intergenic
1197705111 X:129629349-129629371 CTGTGGGACTTGAGTATACATGG + Intergenic
1198502364 X:137264144-137264166 CTGTTGGTCTTGAAGATTCATGG - Intergenic
1199926644 X:152473819-152473841 CTGAGGGTTTTGATCATAAAGGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1201460189 Y:14213903-14213925 CTGGGGGTCTGAAGGATCAAGGG - Intergenic
1202259086 Y:22950761-22950783 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202412072 Y:24584505-24584527 CAGTGGGACTTGGGGATACAAGG - Intergenic
1202458708 Y:25085563-25085585 CAGTGGGACTTGGGGATACAAGG + Intergenic