ID: 1155472626

View in Genome Browser
Species Human (GRCh38)
Location 18:26206778-26206800
Sequence GGTTAACTCAAGTGACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155472623_1155472626 15 Left 1155472623 18:26206740-26206762 CCTATTTCAGTTGAGATCTTTTG No data
Right 1155472626 18:26206778-26206800 GGTTAACTCAAGTGACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155472626 Original CRISPR GGTTAACTCAAGTGACCTCA AGG Intergenic
No off target data available for this crispr