ID: 1155473453

View in Genome Browser
Species Human (GRCh38)
Location 18:26214506-26214528
Sequence TTAAGGAACTTAAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155473449_1155473453 -9 Left 1155473449 18:26214492-26214514 CCCAGGCCCTTTTGTTAAGGAAC No data
Right 1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG No data
1155473450_1155473453 -10 Left 1155473450 18:26214493-26214515 CCAGGCCCTTTTGTTAAGGAACT No data
Right 1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155473453 Original CRISPR TTAAGGAACTTAAAGTGTTC TGG Intergenic
No off target data available for this crispr