ID: 1155474567

View in Genome Browser
Species Human (GRCh38)
Location 18:26225403-26225425
Sequence GCACTATGCCTAGCAAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155474567_1155474576 14 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474576 18:26225440-26225462 TCCAGCTACTCGGGAATCTGAGG 0: 2
1: 291
2: 10067
3: 137506
4: 312457
1155474567_1155474572 4 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474572 18:26225430-26225452 CCCCTGTGGTTCCAGCTACTCGG No data
1155474567_1155474574 5 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474574 18:26225431-26225453 CCCTGTGGTTCCAGCTACTCGGG No data
1155474567_1155474579 21 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474579 18:26225447-26225469 ACTCGGGAATCTGAGGTAGGAGG No data
1155474567_1155474569 -10 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474569 18:26225416-26225438 GGCATAGTGCCGCTCCCCTGTGG No data
1155474567_1155474581 26 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474581 18:26225452-26225474 GGAATCTGAGGTAGGAGGGTAGG No data
1155474567_1155474580 22 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474580 18:26225448-26225470 CTCGGGAATCTGAGGTAGGAGGG No data
1155474567_1155474578 18 Left 1155474567 18:26225403-26225425 CCCGTTTTTGCTAGGCATAGTGC No data
Right 1155474578 18:26225444-26225466 GCTACTCGGGAATCTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155474567 Original CRISPR GCACTATGCCTAGCAAAAAC GGG (reversed) Intergenic
No off target data available for this crispr