ID: 1155475170

View in Genome Browser
Species Human (GRCh38)
Location 18:26230508-26230530
Sequence TCTGAAAATCAAACAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155475170_1155475174 11 Left 1155475170 18:26230508-26230530 CCATCCACTGTTTGATTTTCAGA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1155475174 18:26230542-26230564 GCGTAAAGTGATAGTGGCCATGG 0: 1
1: 0
2: 0
3: 2
4: 83
1155475170_1155475175 25 Left 1155475170 18:26230508-26230530 CCATCCACTGTTTGATTTTCAGA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1155475175 18:26230556-26230578 TGGCCATGGCATTACTCTGTCGG 0: 1
1: 0
2: 1
3: 11
4: 120
1155475170_1155475173 5 Left 1155475170 18:26230508-26230530 CCATCCACTGTTTGATTTTCAGA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1155475173 18:26230536-26230558 GAGTTGGCGTAAAGTGATAGTGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155475170 Original CRISPR TCTGAAAATCAAACAGTGGA TGG (reversed) Intronic
900762060 1:4479835-4479857 GCTGAACCTCAAATAGTGGAAGG + Intergenic
901608400 1:10476961-10476983 GCTGAAAATCAAACAAGTGATGG - Intronic
904143400 1:28370688-28370710 TTTTTAAAACAAACAGTGGAAGG + Intronic
907795891 1:57716656-57716678 TCATAAAATCAAACAGGGCAAGG + Intronic
908530100 1:65026165-65026187 TCTGGAAAGCAAACACTGGCTGG - Intergenic
908930750 1:69313722-69313744 TCTTAGAATCAAAGAGTGAAAGG - Intergenic
909184628 1:72470885-72470907 TCAGACATTCAAACAGTTGACGG - Intergenic
909246916 1:73298308-73298330 TCTAGAAATCAAACAGTGCTTGG + Intergenic
910492623 1:87789216-87789238 CCTGATAATCAAAGAGTGAAAGG - Intergenic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
917963328 1:180163022-180163044 TCTTAAAAGGAAACAGTGAAAGG - Intronic
919292429 1:195649559-195649581 CCTGAAAATAAAATAGTGGTTGG - Intergenic
919457578 1:197838378-197838400 TCAGAAGATCAAACTTTGGAAGG - Intergenic
919932421 1:202229964-202229986 TCTGAAAAGCAAGCAATGGAAGG - Intronic
921129653 1:212208727-212208749 ACTGTAAATCAAAGAGTGAATGG - Intergenic
921394981 1:214659047-214659069 TCTGGATCTCAAACAGTAGACGG - Intronic
921646747 1:217627688-217627710 GCTCAAAATCAAACCGTGAATGG + Intronic
921859357 1:220025614-220025636 TATTAAAGACAAACAGTGGAAGG - Intronic
922150956 1:223003956-223003978 TGAGACATTCAAACAGTGGATGG + Exonic
923281957 1:232451947-232451969 TCTCAAAAGCATACACTGGAAGG + Intronic
923848414 1:237764298-237764320 TCTGTAAATTAAACAGTGGGAGG - Intronic
923934933 1:238749140-238749162 TCTGAACATCAAAGGGAGGAAGG + Intergenic
1063473231 10:6306020-6306042 TCTAAAAATAAAAAAGAGGAAGG - Intergenic
1065095521 10:22277083-22277105 TTTGAAAATAAAACATTAGAAGG + Intergenic
1065172642 10:23047357-23047379 TCTGAAACTCAACCAGTGACAGG - Intergenic
1066182101 10:32972931-32972953 TCTGAAAATCAAAAAGTCCTGGG - Intronic
1066200471 10:33139150-33139172 TCTGAAAACCAAGCTGTTGATGG - Intergenic
1066972511 10:42325295-42325317 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1068237484 10:54257507-54257529 TCTGAAAAATAAACAAAGGAGGG - Intronic
1068287315 10:54956904-54956926 GCTCGAAATCAAACAGTGAATGG + Intronic
1068843362 10:61641068-61641090 TCTGTTAATCACACAATGGAAGG - Intergenic
1069513778 10:69061392-69061414 TCTGAAGATTAAACATGGGATGG + Intergenic
1070039356 10:72759963-72759985 TCAAAATATCAAAGAGTGGATGG - Intronic
1071026874 10:81125091-81125113 TCTAAAAATCAAACAGTTTTTGG - Intergenic
1073452440 10:103617811-103617833 TCTGAAGGTCAGACAGAGGAAGG - Intronic
1073815227 10:107199088-107199110 GCTGAAACTCAAACCATGGAGGG - Intergenic
1075256805 10:120931811-120931833 TGAGTAGATCAAACAGTGGAAGG - Intergenic
1075818573 10:125285487-125285509 TCTGAAACTAAAATAGTGCATGG + Intergenic
1077949888 11:6944942-6944964 TCTAAATGTCCAACAGTGGAGGG - Intronic
1078113491 11:8420979-8421001 TCTGAAAAAAAAAAAGGGGAGGG + Intronic
1078253124 11:9634859-9634881 TCTCAAAATAAAACAGAGAAAGG - Intergenic
1079928411 11:26525449-26525471 TCTGAAATTAAAACAATGTAAGG + Intronic
1080941585 11:36924166-36924188 TCTGAATATCAAACATATGAGGG + Intergenic
1082268644 11:50145628-50145650 TCTGAAATTGAAACTCTGGAGGG - Intergenic
1082287480 11:50333443-50333465 TCTGAAATTGAAACTCTGGAGGG + Intergenic
1083573825 11:63774790-63774812 TCATAGAATCAAACTGTGGAAGG - Intergenic
1084316423 11:68348349-68348371 TCTGAAAATGAACCCGTGGGGGG + Intronic
1084739837 11:71132415-71132437 TCTGTAAATCCCACAGTGTAGGG - Intronic
1085316119 11:75546062-75546084 TGTTCTAATCAAACAGTGGAGGG - Intergenic
1086453837 11:86942583-86942605 GATGAAAATCAGGCAGTGGATGG + Intronic
1091648746 12:2293690-2293712 TCTAAAGGTCAAACTGTGGAAGG - Intronic
1092778092 12:11961576-11961598 TCTGAAAAACATACACTGAAAGG - Intergenic
1092899779 12:13047302-13047324 TTTGAAGGTCAAACACTGGAGGG + Intronic
1093818405 12:23579252-23579274 TCTGAAAGCCAAAAAGTGCAAGG + Intronic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1094718976 12:33042709-33042731 TCTGAAAATTAAAAAGTTAAAGG - Intergenic
1094803207 12:34062471-34062493 TCATAAAATCATAGAGTGGAAGG - Intergenic
1095116615 12:38360983-38361005 TCATAAAATCATAGAGTGGAAGG - Intergenic
1095456651 12:42392740-42392762 TCTGAAAATCAATCAGCCAATGG - Intronic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1098361416 12:69657899-69657921 TCTGACCCTCACACAGTGGAGGG - Intronic
1098814517 12:75141181-75141203 TTTGAAAATAAAACATTTGAGGG - Intronic
1100927671 12:99567948-99567970 TCTGAAAACCTCACAGTGGAAGG - Intronic
1102586566 12:113927184-113927206 GATGAAAATCCAACAGAGGAAGG - Exonic
1102811163 12:115825114-115825136 TCTGAAAGCCCAACCGTGGATGG + Intergenic
1103391265 12:120575231-120575253 TCTAAAAAACAAAAACTGGAGGG + Intronic
1104525827 12:129520425-129520447 TGTGAAAATCAAATAATGAAAGG - Intronic
1105228078 13:18456579-18456601 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1106570129 13:30919746-30919768 TCTAAAAATCACACAGTGGCTGG + Intronic
1107303005 13:38985646-38985668 CCTGAAAATATAACAATGGAGGG + Intronic
1107760811 13:43676483-43676505 TCTGAAAGAGAAACAGTGAAGGG + Intronic
1108024183 13:46161603-46161625 TCTGAAAAAGAAAGAGAGGAAGG - Intronic
1109030430 13:57182302-57182324 TCTGGAACTCAAAGAGAGGAAGG - Intergenic
1109127493 13:58535508-58535530 TTTGAAAATTAAAGAGTGCATGG - Intergenic
1110585793 13:77190710-77190732 TATGAAAATCATACAGTCCAGGG + Intronic
1110672181 13:78193675-78193697 TATTAAACTCAAACAGAGGAAGG - Intergenic
1112892726 13:104258604-104258626 TATGAGAATGAAACAGTTGAAGG + Intergenic
1112972782 13:105281453-105281475 TCTAAAAAACAAAAAGTTGATGG - Intergenic
1114641160 14:24222197-24222219 TCTAAATATCAAACAGTTGAGGG + Intronic
1115571695 14:34672725-34672747 TCTGAAAACCAGGCAGTCGATGG - Intergenic
1115681285 14:35741119-35741141 ATTGAAAAACAAACAATGGAAGG - Intronic
1117916866 14:60687038-60687060 TTAGCAAATCAAACAGTGAAAGG + Intergenic
1117946404 14:61028054-61028076 TTTGAAAACCAAAGAGTTGAGGG + Intronic
1120110327 14:80546847-80546869 TTTGAACATCAAACAGTAAAAGG - Intronic
1124166517 15:27330963-27330985 TCTGAAAATCAGGGAGTGGCAGG + Intronic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1124365915 15:29071630-29071652 TCTGAAATTCACACAGTGGGAGG - Intronic
1125275489 15:37985107-37985129 TCTTAGAATCAAAGAGTGGGTGG + Intergenic
1126539524 15:49806324-49806346 TCTGATTATCAAACCGAGGATGG - Intergenic
1126953500 15:53909455-53909477 TGTGAAAATGAAACAGTGGCCGG + Intergenic
1127723449 15:61725155-61725177 TCAGATAATTAAATAGTGGAGGG + Intergenic
1129478683 15:75806062-75806084 TCTGAAAATAAAATAGTAGGTGG - Intergenic
1129982950 15:79891108-79891130 TCTGTAAGACAAAGAGTGGATGG + Intronic
1131593099 15:93770182-93770204 TATAAAAATCAATCCGTGGACGG + Intergenic
1134038105 16:11047498-11047520 TCTGAAATTTTAACAGTGGTGGG - Intronic
1134054252 16:11159410-11159432 TTTGAAAATCAGACAGGGCAAGG - Intronic
1134434014 16:14238197-14238219 ACTGAACATCCAACAGTGCACGG + Intronic
1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG + Intronic
1141863560 16:86734435-86734457 TCTGAAATTCAAATATTGCATGG + Intergenic
1142773157 17:2114467-2114489 TCTGCAAGTCTAACAGTGGGTGG + Intronic
1147298301 17:39502742-39502764 TCTGAAAAACTGACAGTGGGTGG + Intronic
1148685931 17:49501252-49501274 GCTGGAAATCAAACCGTGGCAGG + Intronic
1149152703 17:53588342-53588364 TCTGAAAATCTACCATTGGTTGG - Intergenic
1149158541 17:53663690-53663712 TCATAAAATCATAGAGTGGAAGG + Intergenic
1149413858 17:56437665-56437687 TCTGAAAGTCAAATTGGGGAAGG - Intronic
1149421574 17:56516102-56516124 TTTGAAAATCAGTCACTGGAGGG - Intergenic
1150533372 17:66009753-66009775 GCTGAAGATCACACAGTTGAAGG + Intronic
1150686195 17:67322773-67322795 TTTGAAAATTAAACACTGGGTGG - Intergenic
1150844082 17:68637271-68637293 TCTAAAAATGAAACACTGGTGGG - Intergenic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1151129542 17:71882219-71882241 TCTGAAAATCCATCATTGCAAGG + Intergenic
1153369201 18:4294886-4294908 TCAGAGAATCAGCCAGTGGATGG - Intronic
1154525303 18:15282896-15282918 TCTGTAAATCAAAAAGAAGATGG + Intergenic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1158027568 18:52919610-52919632 TCTGAAAATGGAAAAGTCGATGG + Intronic
1158608187 18:58914787-58914809 TTTGAAAATCAAACTGTTGAGGG + Intronic
1158704286 18:59777641-59777663 TCAGAAAATCAAATACTGCATGG + Intergenic
1160086277 18:75780217-75780239 TTTAAAAATCTAACAGTGAATGG - Intergenic
1161805863 19:6442547-6442569 TCTAAAAAACAAAAAGTGGGTGG - Intronic
1163112220 19:15168535-15168557 TCTAAAAATCATACAATGGCCGG + Intronic
1163901933 19:20109980-20110002 TCATAAAATCAGAAAGTGGAAGG - Intronic
1163947118 19:20548456-20548478 TCATAAAATCAGAAAGTGGAAGG + Intronic
1164128542 19:22340594-22340616 TTTGAAAATAATACAGTGCACGG - Intergenic
1164170983 19:22725050-22725072 TTTGAAAATAATACAGTGCATGG + Intergenic
1165857096 19:38885883-38885905 TCTTAAAAGAAAACAGTGGCCGG - Intronic
925825686 2:7846578-7846600 TCTGAAAGGCAAACAGAGGGTGG + Intergenic
927374952 2:22402849-22402871 TCAGAAAATGATACAGAGGAAGG + Intergenic
927438697 2:23093272-23093294 TCTGAAAATAAATCAATGAAAGG + Intergenic
929316636 2:40486941-40486963 ACAGAAAATCAAACACTGCATGG + Intronic
929956393 2:46461628-46461650 CTTGAAAATCAACCAGGGGAGGG + Intronic
930712489 2:54562019-54562041 TCTGAAAAAGAAAAAGAGGAAGG - Intronic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931823622 2:65976956-65976978 TCTGAAAATGAAGAAGAGGAAGG - Intergenic
933977313 2:87521928-87521950 TCTGGAGACAAAACAGTGGATGG + Intergenic
934755379 2:96820818-96820840 TCTTAAAACCAAACAGCAGAAGG - Intronic
934909187 2:98235021-98235043 TTTCAAAATCAAACCATGGAGGG - Intronic
936274242 2:111079672-111079694 TCTGAAAAATAAATAGTGGCAGG - Intronic
936316509 2:111428877-111428899 TCTGGAGACAAAACAGTGGATGG - Intergenic
937487971 2:122335559-122335581 TCTGAACATAAAAGAATGGAGGG - Intergenic
937671580 2:124543247-124543269 TCTATAAATAACACAGTGGAAGG + Intronic
938524488 2:132115019-132115041 TCTGTAAATCAAAAAGAAGATGG + Intergenic
939263324 2:139838011-139838033 TGTAAAAATCAAACAATGCATGG + Intergenic
940354166 2:152719933-152719955 TATGAAAATCAAGCATTGTAAGG - Intronic
941752868 2:169151746-169151768 TCTGAAAACCAACCAGGGAATGG - Intronic
941892146 2:170593775-170593797 GCTGGAAACAAAACAGTGGAAGG - Intronic
942180200 2:173373077-173373099 TCTCAAAAAAACACAGTGGATGG - Intergenic
942988774 2:182174481-182174503 TCTGAGAGTCAATCAGGGGAGGG + Intronic
943497106 2:188634672-188634694 TCTGAAAATTAAATATTAGAGGG + Intergenic
943823268 2:192354957-192354979 TTTAAAAATAAAACCGTGGAGGG + Intergenic
943848416 2:192683453-192683475 GCTGAAAATCAAACATTCTACGG + Intergenic
944989777 2:205222301-205222323 TCTCAAAGTCACACAGTAGAAGG + Intronic
945561761 2:211348360-211348382 TATGAGAATCAAACAATGGCAGG - Intergenic
946359127 2:219208456-219208478 TCTGCAAAGCAATCACTGGAGGG - Exonic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947659751 2:231857669-231857691 TCTGCAAAGCCAACATTGGAAGG - Intergenic
948302204 2:236915879-236915901 TCTTAAAATCAAAACGTGGGTGG - Intergenic
948401681 2:237690063-237690085 TCTGAAAACCATACAGGGAAGGG - Intronic
948634004 2:239322554-239322576 TGGGAAAGTCAAACAGTAGATGG - Intronic
1169320718 20:4631276-4631298 GCAGAAAATCAAACAATGGGAGG - Intergenic
1169530910 20:6483989-6484011 ACTGAAATTAAAACAGTGGCCGG + Intergenic
1170572667 20:17641236-17641258 TCTGAACAGCAAACGGTGGTGGG - Intronic
1170620644 20:17992987-17993009 TCTCAAAACTAAACACTGGAAGG - Intronic
1172958656 20:38781188-38781210 TCTGAAAAAATAACAGTGAAAGG + Intergenic
1173179108 20:40788705-40788727 TCTGAAAAACACAAAGTGTATGG - Intergenic
1174229711 20:49035819-49035841 TCTTAACAACAAACAGTGGATGG + Exonic
1174540626 20:51286464-51286486 TCTGAAAGCCAGACAGGGGAGGG + Intergenic
1174725159 20:52853865-52853887 TCTCAAAATCAAACATTGAGTGG - Intergenic
1174869874 20:54172952-54172974 GCTGGAGATCAAACCGTGGAAGG - Exonic
1175326769 20:58135017-58135039 TCTGAAAAGCACACACTGTATGG + Intergenic
1175565138 20:59969113-59969135 TCTGCAAACCAAACATTGGCAGG - Intronic
1176772126 21:13085594-13085616 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1177080245 21:16630739-16630761 CCTGAAAAACAAACAGCCGAAGG - Intergenic
1177657238 21:24034123-24034145 TCTGAAAAACAAAAACAGGATGG + Intergenic
1178104932 21:29307480-29307502 GCTGAAAGTAAAACAGTGGGTGG - Intronic
1178116646 21:29424622-29424644 ACTGGAAATCAAACAGTAGTAGG + Intronic
1179113063 21:38463833-38463855 ACTGAAAGTCAAACTCTGGACGG - Intronic
1179770428 21:43611446-43611468 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1179917023 21:44484412-44484434 CCTGAAAAGGAAACAGTGGGGGG - Intergenic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1182172799 22:28249879-28249901 TCTCAACATGAAACAGTGAATGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182972088 22:34588813-34588835 TCTGAAAACCAAAAATAGGAAGG + Intergenic
1184602208 22:45550347-45550369 TCTGAAGATCAGCCAGTGGAGGG + Intronic
1184633432 22:45804866-45804888 TCTGAACAAGAAACAATGGAAGG - Intronic
950366474 3:12488752-12488774 TCTCAAAATCAGACGGTGAAGGG - Intronic
950662220 3:14473543-14473565 TCTGAAGGTCAAGCAGAGGAGGG + Intronic
953166413 3:40469099-40469121 TCTCAAAAACAAACAGAGGCTGG - Intergenic
953582115 3:44166817-44166839 TGGGAAAACCAAACAGAGGAGGG - Intergenic
954495516 3:50956095-50956117 AATGCAAATCAAACAGTGGCTGG - Intronic
954636910 3:52075985-52076007 TCTGCAAAATAAACAGTGGTTGG + Exonic
955482830 3:59406723-59406745 TGTGAATGTCAAAGAGTGGAGGG + Intergenic
955641656 3:61092087-61092109 TCTGAAAAAAAAAGAGTGGTGGG + Intronic
955878275 3:63517127-63517149 TTTGTAAACCAAACAGTGGACGG + Intronic
956910346 3:73809773-73809795 TCTGAAATTGAAACTCTGGAGGG - Intergenic
958075573 3:88672825-88672847 TCTGAAATTCCTACAGTGTATGG + Intergenic
958538405 3:95434088-95434110 TCAGAAAATGTAGCAGTGGAAGG - Intergenic
958586768 3:96097113-96097135 ACAGAAAATCAAACACTGCATGG + Intergenic
959336451 3:105071733-105071755 TCTGAATAGCAAACAGTAGTGGG + Intergenic
960169866 3:114447547-114447569 TCTGAAATGCAAACAGTGCAGGG - Intronic
960316509 3:116184916-116184938 TCTGAGAATCAAACAGATCATGG - Intronic
960637849 3:119801673-119801695 TCAGAAAATGAAACAGTGGTGGG - Intronic
964603720 3:158534899-158534921 TCTCAAAAATAAACAATGGAGGG + Intronic
965124362 3:164606588-164606610 TCTTAATATGAAACTGTGGAAGG + Intergenic
965407813 3:168292642-168292664 TATTAAAAACAAAAAGTGGAAGG - Intergenic
965702068 3:171468142-171468164 ACTGAAATTGGAACAGTGGAAGG + Intergenic
967457917 3:189711202-189711224 TCTGAAAAGCAAATTGTAGATGG - Intronic
968825324 4:2891878-2891900 TCTGAAAATTAAATTGTAGAAGG + Intronic
969403571 4:6973569-6973591 TCTGGAAAGTAAACAGTGGCAGG + Intronic
970626044 4:17884036-17884058 TCTAAAAATGGAACAGTTGATGG - Exonic
971086179 4:23278099-23278121 ACAGAAAATCAAACACTGCATGG + Intergenic
971119340 4:23686827-23686849 TCTGAAAATCAGAGGTTGGAAGG - Intergenic
973733634 4:53848499-53848521 TCTGAAAGTAAAACTGTGGTGGG - Intronic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976769077 4:88631933-88631955 TCTGAAAAACAAATAGTGGCAGG + Intronic
977413185 4:96694431-96694453 TCTGGAAATCAACCAGAGAAGGG + Intergenic
978052789 4:104223099-104223121 AATGAAAATCAAAGACTGGATGG - Intergenic
978998706 4:115189255-115189277 TCAGAAAACCAAACATTGCATGG - Intergenic
979103079 4:116647571-116647593 TCTGAAAATTTAACAGTGATGGG + Intergenic
980034716 4:127870790-127870812 TCTGAAAATAAAGCAGGGAAGGG + Intergenic
980722015 4:136710253-136710275 TTTGAAAATAAAATAGGGGAAGG - Intergenic
981098686 4:140807586-140807608 TTCTAAACTCAAACAGTGGAGGG + Intergenic
984614544 4:181882007-181882029 TCAGAAAGTCAAACACTGCAGGG + Intergenic
986501610 5:8406876-8406898 TCTTAAAATAAAACAGAGTAAGG - Intergenic
986553418 5:8983802-8983824 TCTAAAAATTAAACTTTGGAAGG + Intergenic
988444806 5:31273804-31273826 TCTGGAAATTAAAAAGTGAAAGG - Intronic
989089108 5:37710906-37710928 TCTGAAAAGTAAACAGTAGTAGG - Intronic
989644979 5:43621381-43621403 AATGAAAATCAATCAGTTGAAGG + Intronic
990392023 5:55332946-55332968 TCTGAAAATGAGACAGATGACGG - Intronic
992311546 5:75506022-75506044 TCTGAAGATGAAACAGAGTATGG - Exonic
992855924 5:80861690-80861712 TCTGAGAGTCAAAAAGTGCAGGG - Intronic
992958178 5:81931814-81931836 TGTGAATATCAAACAGTGGGTGG + Intergenic
993064335 5:83079384-83079406 TCTGAAAACCAAAAAGTAGGGGG - Intronic
993911791 5:93692307-93692329 GCTCAAAATAAAACAATGGAGGG + Intronic
996637598 5:125712816-125712838 TCTGAAAATCAAAGATTAAAAGG + Intergenic
996992042 5:129646897-129646919 CCTGAAAATCAAATAGATGATGG - Intronic
998895135 5:146790750-146790772 TCTGAAAATCCTACAATGGCAGG + Intronic
999791919 5:154948236-154948258 TATGAAAATGATACAGTGGGGGG - Intronic
999807660 5:155098041-155098063 TCTAAAAAACAAAAAATGGATGG - Intergenic
1000488418 5:161878179-161878201 TCTGAAGCTTAAACAGTGAAGGG - Intronic
1002412084 5:179088972-179088994 TCTGAAGATCACACAGCGCAGGG - Intergenic
1004632423 6:17434686-17434708 TTTCAAAAACAAACACTGGAAGG - Intronic
1004913405 6:20308348-20308370 GCTGAAAAGCTATCAGTGGACGG + Intergenic
1006554060 6:34850989-34851011 TCTAAAAATCAAGCAGAGGCTGG - Intronic
1006933489 6:37701501-37701523 TCTGAAAATCATACAGTGGCAGG + Intergenic
1007064495 6:38976115-38976137 TCTTAAAATCAAATAATAGAGGG + Intronic
1008251329 6:49243568-49243590 TGTGGAAATCCAACAATGGAGGG - Intergenic
1008816283 6:55570651-55570673 ACTGAAAACCAAATATTGGATGG - Intronic
1008964477 6:57300494-57300516 TCTGAAAATCGGGTAGTGGATGG + Intergenic
1010316597 6:74458473-74458495 TCTGAAAGTAAAACAGTGTCTGG - Intergenic
1010753193 6:79637394-79637416 TTTGAAAATCAAAATGTGGCCGG + Intronic
1013020237 6:106207670-106207692 GCTGAAAATCAGACAATGTATGG + Intronic
1013156253 6:107492997-107493019 TCTCAAAGTCAAAAGGTGGAAGG + Intronic
1013326777 6:109053706-109053728 TCTGAAATTCAAACACTTAAGGG + Intronic
1013455950 6:110329917-110329939 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1013509643 6:110832801-110832823 CCTAAAAAACAAAAAGTGGATGG - Intronic
1013628953 6:111966557-111966579 TTTCAAAATAAAACATTGGAGGG + Intergenic
1013644262 6:112120534-112120556 TCTTAAAATAATACAGTGTAAGG + Intronic
1015730671 6:136344710-136344732 TCAGAAAGTCAGACAGGGGAGGG + Intronic
1016694922 6:146982049-146982071 TCTGGAGATCAAAAAGGGGAAGG + Intergenic
1017340014 6:153310147-153310169 TTAGAAAGTGAAACAGTGGAAGG - Intergenic
1020495742 7:8851220-8851242 TCTGAAAATAAAATAGTTGGGGG + Intergenic
1021318331 7:19179544-19179566 TTTAAAAATCTGACAGTGGAAGG - Intergenic
1021569997 7:22055523-22055545 TCTGAATATGAGACTGTGGATGG - Intergenic
1023193596 7:37610133-37610155 TCTCAAAAAAAAAAAGTGGAAGG + Intergenic
1023688219 7:42758934-42758956 TCTGAAGATCCAACTGGGGAAGG + Intergenic
1024755701 7:52528055-52528077 TCTTAAATTCTAACAGAGGAAGG + Intergenic
1025765736 7:64446365-64446387 TCTTAGAAACAAACAGTGAAAGG + Intergenic
1026304713 7:69130664-69130686 ACTGAAAATCACACAATGGCAGG + Intergenic
1027749126 7:82119192-82119214 TTTGAAAAGAAAACACTGGAAGG - Intronic
1028443930 7:90896593-90896615 TCTGAAGAAGAAACAGTGAAGGG - Intronic
1028750335 7:94375756-94375778 TCTGAAAAAGAAAAAGTGGAGGG + Intergenic
1034252364 7:149702356-149702378 TCTGCAAATGAAGCAGTGGGTGG + Intergenic
1036100462 8:5776778-5776800 TCATAAAATCGAACAGTGAATGG - Intergenic
1037182020 8:16018621-16018643 TCTTAAAGACAAACAGTGTAGGG - Intergenic
1037371694 8:18186716-18186738 TCTGTAAAGCAATCACTGGAAGG - Intronic
1038647032 8:29370517-29370539 TCTGGAATTCATGCAGTGGAGGG + Intergenic
1039796364 8:40918840-40918862 TCTGAAAAAAACACAGTGGAAGG + Intergenic
1040537826 8:48325110-48325132 TCAGAAAATCAAACCATGCAAGG - Intergenic
1040830070 8:51666351-51666373 CATGGAAACCAAACAGTGGATGG - Intronic
1041860254 8:62504641-62504663 TCTGATAATGAAATAATGGATGG - Intronic
1042077115 8:65008105-65008127 TCTGAAAGTCAAACTGTAAAAGG - Intergenic
1043747166 8:83889513-83889535 ACAGAAAATCAAACACTGCATGG + Intergenic
1044644757 8:94427510-94427532 TCTCAAAATCAAATATTTGATGG - Intronic
1045271038 8:100661824-100661846 TCTCAAAAAAAAACAGTGGCTGG - Intronic
1045758607 8:105575173-105575195 GATGAAAGTCAAACAGTGGTCGG + Intronic
1045876543 8:106988044-106988066 TCAGAAAAGAAAACAGTTGAAGG + Intergenic
1046362262 8:113176635-113176657 TCTGAAATTCAAACTCTGGATGG - Intronic
1047135265 8:122070696-122070718 TCTGAAAATCATTAAGTTGAAGG - Intergenic
1047776001 8:128071010-128071032 TCTGCAAATCAAACAGATGTGGG - Intergenic
1048279276 8:133093053-133093075 TCTGAATAGCAAACAGCAGAAGG - Intronic
1048511771 8:135069616-135069638 TCTGAAAAACATACAGAGAATGG - Intergenic
1049142551 8:140969105-140969127 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1049969742 9:811438-811460 GCAGAAGAACAAACAGTGGAAGG - Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050157529 9:2683443-2683465 TCTCAAAAACAAATAGTGTATGG - Intergenic
1051414097 9:16820857-16820879 TCTGAAAATCAAACAGCAATGGG + Intronic
1053032526 9:34793506-34793528 TCTGAAAAATAAACAGTAGCAGG + Intergenic
1053295016 9:36906513-36906535 TCCTAAAATCAAAGAGTGGTGGG - Intronic
1056829288 9:89901518-89901540 TGTGAAACTCAATGAGTGGAAGG + Intergenic
1057909768 9:99009531-99009553 TCTGAAAATCAAAAAATTAATGG + Intronic
1186031277 X:5372033-5372055 ACAGAAGATAAAACAGTGGAAGG - Intergenic
1187027442 X:15450559-15450581 TCTCCACATCACACAGTGGACGG + Intronic
1188942224 X:36254294-36254316 TCTGTAAATTAAAAAGTAGATGG + Intronic
1189764247 X:44353539-44353561 TCTGAAAATCAATCAATGTAAGG + Intergenic
1189853688 X:45201253-45201275 CCTGGAATTAAAACAGTGGAGGG - Intergenic
1189975474 X:46457600-46457622 TCTGAAAGGCAAACAGTAGAAGG - Intronic
1189983987 X:46537424-46537446 TCTGAAAGGCAAACAGTAGAAGG + Intronic
1190842190 X:54155536-54155558 ATTGAAAAGCAAACAGGGGAAGG + Intronic
1192053016 X:67744583-67744605 TCTGAAAATCAGCCACAGGAGGG + Intergenic
1192112685 X:68381480-68381502 TGTGCAAATCAGACTGTGGAGGG - Intronic
1192131476 X:68555606-68555628 TCTGAAAAGTAAACAGTAGCAGG - Intergenic
1192633837 X:72799663-72799685 TCAGAAAGTCAAAGTGTGGAGGG - Intronic
1192647873 X:72921138-72921160 TCAGAAAGTCAAAGTGTGGAGGG + Intronic
1193187855 X:78535004-78535026 TCTGAGATCCAAACAGTAGAAGG - Intergenic
1194085983 X:89529338-89529360 TCTGAAAACAAAACAAAGGATGG + Intergenic
1197193922 X:123679284-123679306 ACTGAAAATTAACCATTGGAGGG - Intronic
1197225915 X:123956240-123956262 TCTGCAATTCTAACACTGGAAGG - Intergenic
1197394464 X:125909600-125909622 TCTGAAAATCATACTGCTGAAGG - Intergenic
1198270245 X:135050175-135050197 TTTGAACATCAAATAGTTGATGG + Intergenic
1200438638 Y:3185204-3185226 TCTGAAAACAAAACAAAGGATGG + Intergenic