ID: 1155483195

View in Genome Browser
Species Human (GRCh38)
Location 18:26312022-26312044
Sequence CACTCCATAGAATCTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155483192_1155483195 -8 Left 1155483192 18:26312007-26312029 CCTAGTTCCCTGTAACACTCCAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1155483195 18:26312022-26312044 CACTCCATAGAATCTTGAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155483195 Original CRISPR CACTCCATAGAATCTTGAGT TGG Intronic
905093170 1:35446181-35446203 CACACAATAGAATCTTGCGGAGG - Intronic
911541471 1:99162929-99162951 GACTTCATAGAATTTTAAGTGGG - Intergenic
911600018 1:99837847-99837869 CACTCAATAACATCTTGAGAAGG - Intergenic
912228141 1:107759531-107759553 TACTCCATAGAATTTTGAGAGGG + Intronic
913642878 1:120829278-120829300 CACTGCATCGAATTTTGACTGGG + Intronic
917051679 1:170931832-170931854 CACTCAATACAAACTTGAGAAGG - Intergenic
917222792 1:172749331-172749353 CAATCCATTGAAACTTCAGTGGG - Intergenic
921717714 1:218435291-218435313 CACTCCAGAGAATCATGACTAGG - Intronic
1064389548 10:14929800-14929822 CACCCCAAAGAAATTTGAGTGGG - Intronic
1069111018 10:64446664-64446686 CTCTCCATGGAATTTTGAGGTGG + Intergenic
1072341642 10:94458308-94458330 CGCTCTATAGAATCCTGAGGTGG - Intronic
1077847728 11:6043745-6043767 CACTCTATGGAATTTTGACTTGG - Intergenic
1078854326 11:15194401-15194423 GACCCCATGGAATCTTGGGTAGG - Intronic
1079008540 11:16809975-16809997 CACTGCATGGAATACTGAGTAGG + Intronic
1081759216 11:45565333-45565355 CACTCCATAGACCCGTCAGTGGG + Intergenic
1081784472 11:45737414-45737436 CACTCCATAAAATCTCTCGTGGG + Intergenic
1086902899 11:92387522-92387544 CCCTCCCTAATATCTTGAGTTGG - Intronic
1089162690 11:116451721-116451743 CAGTCCATAGAAACTTGAAGAGG - Intergenic
1093052803 12:14522130-14522152 CACACTATAGAAACTTGAGAGGG + Intronic
1097436871 12:59560911-59560933 CAAACCATAGCATCATGAGTTGG - Intergenic
1097833396 12:64249559-64249581 GACTACAAAGAATCTGGAGTGGG + Intergenic
1098460054 12:70722523-70722545 GACTCCAAAGAAGCTTGACTTGG + Intronic
1102056687 12:109901586-109901608 AACACCATAAAACCTTGAGTTGG + Intronic
1107079471 13:36359218-36359240 CACTCCATATAATTTTGTGGGGG - Intronic
1115017447 14:28634010-28634032 TCCTCCATGGATTCTTGAGTTGG - Intergenic
1117443726 14:55782938-55782960 CAAGCCATAGAATCTTGCTTGGG + Intergenic
1130111778 15:80971360-80971382 CCCTCCTTAGAAACTTTAGTTGG + Intronic
1133737727 16:8628740-8628762 GGCTCCATAGAAGCTTGAATTGG - Exonic
1137543196 16:49378504-49378526 CACTCCATAGAGGCTTCGGTAGG - Exonic
1137902370 16:52282647-52282669 CACTCAATATAAACGTGAGTGGG + Intergenic
1139043879 16:63032911-63032933 CACTCAATACCATCTTAAGTTGG - Intergenic
1139220539 16:65177146-65177168 TACTCCATGGAAGCCTGAGTTGG + Intergenic
1142490675 17:276851-276873 GAATCCACAGAATTTTGAGTGGG + Intronic
1144535107 17:16081053-16081075 CTCTCCATAGCATTTTTAGTCGG - Intronic
1148130445 17:45259166-45259188 ATCTCCATACAATGTTGAGTAGG + Intronic
1148918670 17:51008253-51008275 CACTCCATTGGATCTTGCATTGG - Intronic
1154052925 18:10979757-10979779 CATTCCATATACTTTTGAGTCGG - Intronic
1155483195 18:26312022-26312044 CACTCCATAGAATCTTGAGTTGG + Intronic
1157147685 18:45181291-45181313 TACCCCATAGAGTGTTGAGTGGG - Intergenic
1157434063 18:47653735-47653757 CAATCCAAAGATTCTTGAGAGGG + Intergenic
1158911732 18:62070355-62070377 TACTCCATAGAAAATTGATTTGG - Intronic
925888155 2:8411302-8411324 TACTCCATTGACTCTTCAGTGGG - Intergenic
929102786 2:38332745-38332767 CAGTCAACAGAAACTTGAGTGGG - Intronic
929315360 2:40471511-40471533 CACTCCATAGGATCAGGGGTGGG - Intronic
933250542 2:80024381-80024403 CACTGCATTGAGTCTTGAGGAGG + Intronic
937091459 2:119209186-119209208 CACTCCCCAGAAGCTTCAGTGGG + Intergenic
939008566 2:136818609-136818631 CACTCCAAAGAACCTGGAATGGG + Intronic
940841125 2:158583077-158583099 CACAGCATAGAATCTTCAGAGGG + Intronic
941930117 2:170930018-170930040 CACTCCAGGAAATCTTGAGAAGG - Intronic
942614138 2:177772272-177772294 CACTCCATAGAATATTTCCTTGG - Intronic
945367332 2:208971501-208971523 AAATCCATAGAATCTGGAATTGG + Intergenic
945687462 2:212989069-212989091 AACCCCATAGAATCATGAGAAGG + Intergenic
1172755391 20:37280198-37280220 CAGCCCACAGAATCCTGAGTTGG + Intergenic
1178248527 21:30977656-30977678 CTCTCTATAGAATCCTGAGGTGG - Intergenic
1182039304 22:27224087-27224109 CACTCCATAAAATCTGCAGTGGG - Intergenic
1182133572 22:27879069-27879091 CCCTCCATAGAGTCCTGAGATGG + Intronic
955067186 3:55543692-55543714 CAGTCCATAGGATCTGGAGGAGG + Intronic
964681004 3:159338581-159338603 CACTGCATAGAAGATAGAGTAGG - Intronic
970661172 4:18287551-18287573 CCCTGCATATAATCTTGAATGGG - Intergenic
971159098 4:24114853-24114875 AATTCCTTAGAATCTTGTGTAGG + Intergenic
972029881 4:34441327-34441349 CAGTTCATAAAATCCTGAGTAGG - Intergenic
975980048 4:80147106-80147128 CACTCCAGAGGATTTTGAGGAGG - Intergenic
976211924 4:82680380-82680402 TACTCCAGAGAATCATGAATGGG + Intronic
978656180 4:111068071-111068093 CACTCCAGAGAATACTGTGTAGG - Intergenic
980770130 4:137361265-137361287 CACTTCAGATAGTCTTGAGTAGG + Intergenic
980837638 4:138216564-138216586 TACTTCACAGAAACTTGAGTAGG - Intronic
983820648 4:172189754-172189776 AACTGCATAGAATCTTAAGATGG - Intronic
988881986 5:35514131-35514153 CTTTCCCTAGAATCTTGAGTGGG + Intergenic
989104991 5:37854418-37854440 CACTCCATAGACTTTTGTGATGG + Intergenic
990982951 5:61618034-61618056 GACTCCATAGAGTCTAGATTTGG - Intergenic
994498827 5:100547977-100547999 CACTCAATAGTATCTTAAGCAGG + Intronic
998429824 5:142061251-142061273 CACTTTATTGAATATTGAGTGGG + Intergenic
999866638 5:155707403-155707425 CACTGCAGAGTATCTTTAGTTGG + Intergenic
1006635184 6:35456812-35456834 CACTCCACAGACTCTTAAGGAGG + Intronic
1008013064 6:46489748-46489770 CAGTCCATAGAATTTTGTGAGGG - Intronic
1010536669 6:77039057-77039079 CACTCCACAGATTCTAGAATAGG + Intergenic
1011941187 6:92845653-92845675 CAGTCCATAGATGCCTGAGTTGG + Intergenic
1024607220 7:51031812-51031834 TACTCCCTAGAATCTTGAACTGG + Intronic
1025271054 7:57517308-57517330 CAGTTCATAAAATCCTGAGTAGG + Intergenic
1028000064 7:85483478-85483500 CACTGCATAAAATGTTGTGTTGG - Intergenic
1031756697 7:125652578-125652600 CTCTCCATAGATTTCTGAGTAGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033728103 7:144143127-144143149 TACTCCATAGAGTTTTCAGTGGG - Intergenic
1038821352 8:30954963-30954985 CACCCCTTGGAATCCTGAGTGGG - Intergenic
1040689516 8:49918569-49918591 CACTCTATAGAATATTCTGTTGG + Intronic
1041325504 8:56659277-56659299 CATTCCATAGAAGCTTCATTTGG - Intergenic
1043496923 8:80811786-80811808 CAGGCCATAGACTCTTGGGTTGG - Intronic
1045772676 8:105762211-105762233 CAGTACATATATTCTTGAGTAGG - Intronic
1050504080 9:6329079-6329101 CACTCCCCGGAATCTGGAGTGGG - Exonic
1050776170 9:9263784-9263806 CACACCACAGACACTTGAGTAGG + Intronic
1055128353 9:72745918-72745940 CACATCATAGAATGTTGAGCTGG - Intronic
1055268644 9:74530001-74530023 TATACCACAGAATCTTGAGTGGG - Intronic
1056782707 9:89563293-89563315 CACTCCACACAAGCTTGAATGGG + Intergenic
1057340712 9:94198748-94198770 AAATTCATATAATCTTGAGTGGG - Intergenic
1187080952 X:15987336-15987358 CACTCCAGATGATCTTGTGTGGG + Intergenic
1189109828 X:38277796-38277818 TACTCAACAGAATCTTTAGTAGG + Intronic
1189266331 X:39719610-39719632 CACTCCACATGATCTTGAGCAGG - Intergenic
1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG + Exonic
1197550643 X:127888360-127888382 CTATCCATATAATCTTGAGAAGG - Intergenic