ID: 1155487767

View in Genome Browser
Species Human (GRCh38)
Location 18:26365295-26365317
Sequence ACAGAATTATAGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2714
Summary {0: 1, 1: 2, 2: 34, 3: 357, 4: 2320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155487767_1155487771 0 Left 1155487767 18:26365295-26365317 CCGCACCTGGCCTATAATTCTGT 0: 1
1: 2
2: 34
3: 357
4: 2320
Right 1155487771 18:26365318-26365340 TCTTGAGGATAAAAGTAGAAAGG 0: 1
1: 0
2: 2
3: 27
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155487767 Original CRISPR ACAGAATTATAGGCCAGGTG CGG (reversed) Intronic
Too many off-targets to display for this crispr