ID: 1155487767 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:26365295-26365317 |
| Sequence | ACAGAATTATAGGCCAGGTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2714 | |||
| Summary | {0: 1, 1: 2, 2: 34, 3: 357, 4: 2320} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155487767_1155487771 | 0 | Left | 1155487767 | 18:26365295-26365317 | CCGCACCTGGCCTATAATTCTGT | 0: 1 1: 2 2: 34 3: 357 4: 2320 |
||
| Right | 1155487771 | 18:26365318-26365340 | TCTTGAGGATAAAAGTAGAAAGG | 0: 1 1: 0 2: 2 3: 27 4: 314 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155487767 | Original CRISPR | ACAGAATTATAGGCCAGGTG CGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||