ID: 1155488573

View in Genome Browser
Species Human (GRCh38)
Location 18:26373788-26373810
Sequence CTGGGTGAACAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 866
Summary {0: 1, 1: 1, 2: 2, 3: 87, 4: 775}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155488573_1155488582 15 Left 1155488573 18:26373788-26373810 CCTCCCTCCCTCTGTTCACCCAG 0: 1
1: 1
2: 2
3: 87
4: 775
Right 1155488582 18:26373826-26373848 TGGCTAGGTCTCAGCTTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 115
1155488573_1155488581 0 Left 1155488573 18:26373788-26373810 CCTCCCTCCCTCTGTTCACCCAG 0: 1
1: 1
2: 2
3: 87
4: 775
Right 1155488581 18:26373811-26373833 TGTTACTGAGTACAATGGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1155488573_1155488579 -5 Left 1155488573 18:26373788-26373810 CCTCCCTCCCTCTGTTCACCCAG 0: 1
1: 1
2: 2
3: 87
4: 775
Right 1155488579 18:26373806-26373828 CCCAGTGTTACTGAGTACAATGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155488573 Original CRISPR CTGGGTGAACAGAGGGAGGG AGG (reversed) Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900414441 1:2528565-2528587 CCGGAAGAACAGGGGGAGGGAGG - Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900672967 1:3867313-3867335 CGGAGTGAACAGACGGAGCGTGG - Intronic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901775980 1:11560658-11560680 CTGGGGGAACAGGGGGATCGGGG + Intergenic
902386528 1:16079100-16079122 CTGGGTCAGCAGACGGCGGGAGG - Intergenic
902542496 1:17164960-17164982 ATGGGAGAACAGAGGGTGTGTGG + Intergenic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902756008 1:18549778-18549800 TTGGGATAACAGAGGAAGGGAGG - Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903179606 1:21598510-21598532 GGGGGTGGAAAGAGGGAGGGAGG + Intronic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
904337959 1:29810283-29810305 CTGGGACCAGAGAGGGAGGGAGG - Intergenic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904471940 1:30741548-30741570 CTGGGTGCTGAGAGGGTGGGAGG - Intronic
905170385 1:36106487-36106509 GTGGGTGGACAGGGGGATGGGGG + Intronic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
905996411 1:42385094-42385116 CTGGTTCTTCAGAGGGAGGGGGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906303789 1:44703349-44703371 CTGGGTGAATGGGGAGAGGGAGG - Intronic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
906753462 1:48287188-48287210 CTGGGTTAAGAGAGTGAAGGGGG + Intergenic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
908055423 1:60280953-60280975 CTGGGTGAATACTGGGAGTGGGG + Intergenic
908150227 1:61293164-61293186 CTCAGAGAAGAGAGGGAGGGAGG - Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
913192552 1:116426024-116426046 GTGGGTGAGCAGAGTGAGCGTGG + Intergenic
913198599 1:116477911-116477933 GTGGATGGACACAGGGAGGGTGG - Intergenic
913313023 1:117522026-117522048 TTGGGGGAAGAGTGGGAGGGTGG + Intronic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
918982896 1:191586647-191586669 CTGGATGAACAGAGTTAGTGAGG + Intergenic
919754929 1:201060857-201060879 GTGGGTGTGGAGAGGGAGGGAGG - Intronic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920245726 1:204585941-204585963 TTGGGGGTTCAGAGGGAGGGCGG + Intergenic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922547233 1:226466999-226467021 CTGCCTGAACTGAGGGTGGGAGG + Intergenic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064264641 10:13815641-13815663 CAGGGTCAACAGAGGTAGAGTGG - Intronic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1064442159 10:15363828-15363850 GTTGGGGAATAGAGGGAGGGAGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067153350 10:43753945-43753967 CTGGCGGAACACAGGGAGTGTGG + Intergenic
1067179543 10:43974248-43974270 CTGGGTGGAACCAGGGAGGGAGG + Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1069303021 10:66932106-66932128 CTGGCTGAAAAGGGGGAGGGAGG - Intronic
1069684517 10:70309134-70309156 CTGGGTGATCAGGGGCAGAGGGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1070469682 10:76766480-76766502 CTGTGTGAAGAAAGGAAGGGAGG + Intergenic
1070739467 10:78893139-78893161 AGGGATGGACAGAGGGAGGGAGG + Intergenic
1070774456 10:79101676-79101698 CTGGGTGAACCAGGGCAGGGAGG + Intronic
1070911569 10:80123434-80123456 CTGGGGGAAGAGAGTGTGGGAGG + Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073955721 10:108869073-108869095 GTGGGTGGACAGAGTGTGGGTGG + Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074101586 10:110358344-110358366 GTGGGGGAACAGAGGGACAGAGG - Intergenic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1074896895 10:117784974-117784996 CTGGGTGCTCAAGGGGAGGGTGG - Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075904400 10:126068386-126068408 CTGGGTGATTTGAGAGAGGGGGG - Intronic
1076021436 10:127076944-127076966 CTTTGAGAACAGAGGCAGGGAGG + Intronic
1076053774 10:127355009-127355031 CTGAGGCAACTGAGGGAGGGAGG - Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076542024 10:131220552-131220574 ATGGGTTCAGAGAGGGAGGGAGG + Intronic
1076545563 10:131243688-131243710 CTTGGTGAACAGAGGGTGTCTGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077103412 11:832075-832097 GTGGGTGAATACAGGGAGCGCGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077315036 11:1915782-1915804 GTGGATGAAGGGAGGGAGGGAGG + Intergenic
1077404855 11:2378280-2378302 CTGGGTGAGGAGAGGGAGATCGG - Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077555566 11:3224440-3224462 CTGGGAGGAAGGAGGGAGGGAGG - Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078146953 11:8728597-8728619 CTAGGTGACCAAAGGGAGTGGGG - Intronic
1078289139 11:9989288-9989310 TGGGGTGAAGAGTGGGAGGGAGG + Intronic
1078941700 11:16013638-16013660 ATGGGAGTAAAGAGGGAGGGAGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1080754693 11:35185573-35185595 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083804539 11:65066174-65066196 ATGGGTGAGCTGAGGGAGTGGGG + Intergenic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085245850 11:75099665-75099687 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085245883 11:75099738-75099760 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086464293 11:87037735-87037757 CTGGGTGAGCGGAGGCAGAGAGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1090081771 11:123618404-123618426 CTGGGGGAAGAGAGGTACGGTGG - Intronic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090550332 11:127812583-127812605 ATGGGTAAATAGTGGGAGGGAGG - Intergenic
1090840049 11:130479530-130479552 CTGGGTGAACACAGGTGGGTGGG - Intergenic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091998611 12:5015320-5015342 CTAGGTGAAAGGATGGAGGGAGG + Intergenic
1092061588 12:5555515-5555537 CTTGGTGAAAAGGGTGAGGGAGG - Intronic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092679180 12:10958398-10958420 CTATGTGAACAGAGAGAAGGAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1094818450 12:34207729-34207751 TGGGAAGAACAGAGGGAGGGAGG - Intergenic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096614266 12:52822920-52822942 CGGGGTCAAGAGAGGGAGAGAGG - Intronic
1096712083 12:53464989-53465011 CTGGGTGAAATGAGGTTGGGGGG - Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1098475903 12:70902729-70902751 CAGGGAGAAGAGTGGGAGGGGGG + Intronic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1101758187 12:107637956-107637978 ATAGGTGAGCAGAGGGAGGCAGG + Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1102988858 12:117300448-117300470 CTGGGTGGTCAGAGCCAGGGTGG - Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1103870139 12:124085457-124085479 CTGGGGGAACAGGGTGATGGGGG + Intronic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104960288 12:132485311-132485333 CTGGGTGAACAGGGAGGGGGCGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107861002 13:44660810-44660832 ATGGGAGGTCAGAGGGAGGGAGG + Intergenic
1107908337 13:45082576-45082598 CTGGGAGGACAGAGTGTGGGAGG - Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1109249740 13:60004992-60005014 TTGAGTGAATAGAGGTAGGGAGG - Intronic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1111586690 13:90291392-90291414 CTGTGTGAACAGTGGAACGGGGG + Intergenic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113990426 14:16023896-16023918 AGGAGAGAACAGAGGGAGGGAGG - Intergenic
1114532152 14:23402905-23402927 CGGGGTGAATGGAGGAAGGGAGG + Intronic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1117403402 14:55378618-55378640 ATAGGGGAACTGAGGGAGGGAGG - Intronic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1119643242 14:76330109-76330131 ATGGGTACACAGAGAGAGGGAGG - Intronic
1120490510 14:85173105-85173127 CTGGGCCAACATAGAGAGGGGGG + Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1122517483 14:102319084-102319106 CTGGATGGATAGAGAGAGGGTGG + Intronic
1122757978 14:103997638-103997660 GGGAGTGCACAGAGGGAGGGTGG + Intronic
1122794228 14:104197940-104197962 GTGGGTGAATGGAGGGAGAGAGG - Intergenic
1123118774 14:105907482-105907504 CTGGCAGAACAGAGGAGGGGAGG - Intergenic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1202859782 14_GL000225v1_random:73659-73681 CTGGGTGGGTAGAGGGAGTGTGG + Intergenic
1123465591 15:20512549-20512571 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1123580782 15:21713356-21713378 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617431 15:22155979-22156001 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123652525 15:22488488-22488510 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1123742947 15:23297347-23297369 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124276313 15:28328528-28328550 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1124306385 15:28583079-28583101 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1124656786 15:31515638-31515660 ATGGATGAAGAGAGAGAGGGAGG - Intronic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124718783 15:32093645-32093667 CCAGGTGAACAGAGGCAGGTGGG - Intronic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125969379 15:43899647-43899669 CTGGAAGGAAAGAGGGAGGGAGG - Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126860960 15:52882647-52882669 CTTGGTGATCTCAGGGAGGGGGG + Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127377416 15:58397946-58397968 CTCAGTTAACTGAGGGAGGGAGG - Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128314740 15:66653499-66653521 CAGGGTGATCAGAGGGGGAGGGG + Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128632837 15:69282845-69282867 CTGGGTGAACCTGGGGTGGGTGG - Intergenic
1128793626 15:70449903-70449925 ATGGGTGGATAGAGGGATGGAGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128793740 15:70450336-70450358 ATGGATGAATAGAGGGATGGAGG + Intergenic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129333830 15:74840899-74840921 CTGGGGGGACAGTGAGAGGGTGG - Intronic
1129899563 15:79136071-79136093 TTGGAGGAACGGAGGGAGGGAGG - Intergenic
1129992039 15:79973865-79973887 GTGAGGGAAAAGAGGGAGGGAGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130216306 15:81973746-81973768 AGGGAAGAACAGAGGGAGGGAGG + Intergenic
1130220799 15:82018008-82018030 CTGGGAGAAGAGAGGATGGGTGG + Intergenic
1130754120 15:86744685-86744707 CTCAGTGCAAAGAGGGAGGGTGG - Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1131480258 15:92774646-92774668 GCGGGTGAAAGGAGGGAGGGTGG + Intronic
1131636363 15:94236945-94236967 GTGGGTGATGAGAGAGAGGGAGG + Intronic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132226768 15:100148880-100148902 CTGGGAGAAGAGTGGCAGGGAGG + Intronic
1202989652 15_KI270727v1_random:447601-447623 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1132465957 16:77599-77621 CTGGGCGGAAAGAGGGATGGGGG + Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1133883759 16:9807229-9807251 GTGGGGGGAGAGAGGGAGGGAGG + Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134316891 16:13127109-13127131 CTGAGGGAACAGAGAGAGGGAGG + Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135899758 16:26446183-26446205 CTTGGTGGACAGACTGAGGGAGG - Intergenic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1135993726 16:27232799-27232821 CTGGGTGAACGGGGAGTGGGAGG + Intronic
1136110394 16:28061085-28061107 GTGTGTGCACAGAGGAAGGGAGG + Intronic
1136247182 16:28982834-28982856 CTGGGGGAAGAGAGGGTCGGGGG - Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137708591 16:50551222-50551244 TTGGGGGAAGTGAGGGAGGGTGG + Intronic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139532975 16:67552502-67552524 AGGGGACAACAGAGGGAGGGAGG + Intergenic
1140200248 16:72889053-72889075 ATGGGTGGAGGGAGGGAGGGAGG + Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141314305 16:82946212-82946234 ATGGATGAATGGAGGGAGGGAGG + Intronic
1141501984 16:84450695-84450717 CTGGGTGATCTGAGAGGGGGTGG - Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1141690299 16:85592958-85592980 CTGGCTGAACAGAGGTGGCGGGG - Intergenic
1141713928 16:85716327-85716349 TTGGGGGAGAAGAGGGAGGGAGG + Intronic
1141746482 16:85929791-85929813 GCGGGAGACCAGAGGGAGGGAGG + Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142196874 16:88743051-88743073 GTGGGTGCACAGAGAGAGAGAGG - Intronic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1143103817 17:4518669-4518691 ATGGGGGAACGGAGGGAGAGTGG + Intronic
1143769148 17:9156957-9156979 GTGGGTGGAGGGAGGGAGGGAGG - Intronic
1144573904 17:16417109-16417131 AGGGGTGAGGAGAGGGAGGGAGG - Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146422234 17:32698341-32698363 AGGGGGGAAGAGAGGGAGGGAGG - Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147445726 17:40474286-40474308 GTGGGAGAAGAGAGGGAGGGAGG + Intergenic
1148462299 17:47845796-47845818 CCGGGTGAAGAAAGGGAGCGAGG + Exonic
1149508946 17:57221182-57221204 GTTGGAGAAGAGAGGGAGGGAGG + Intergenic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151951688 17:77357805-77357827 CTGGGTGAATACAAGGAGTGAGG - Intronic
1151965697 17:77430141-77430163 CTGGGAGAACAGGGGCTGGGAGG - Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152441514 17:80312780-80312802 ACGGGAGAAAAGAGGGAGGGAGG - Intronic
1152554936 17:81048478-81048500 CTTGGGGAACAAAGGGAGAGTGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153978566 18:10290498-10290520 GTGGAAGAACAGGGGGAGGGAGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154496316 18:14963801-14963823 CTAGGTGAGCAGAGAGCGGGAGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158346481 18:56521512-56521534 GTTGCTGAACACAGGGAGGGAGG - Intergenic
1159917386 18:74199029-74199051 CCGGGTGAACTGCTGGAGGGAGG + Intergenic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160789536 19:917212-917234 CTGGGTGAATAGAGGGCGCGTGG + Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161313486 19:3607340-3607362 GTGGGAGGACAGAGGGATGGGGG + Intergenic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163041861 19:14608591-14608613 TTGGGAGAAAAAAGGGAGGGTGG + Intronic
1163078274 19:14915986-14916008 CTGGGAGAATTGGGGGAGGGGGG + Intergenic
1163238405 19:16043317-16043339 ATGGATGAATGGAGGGAGGGAGG + Intergenic
1163524562 19:17812794-17812816 CTTGGGGAACACAGGGATGGGGG - Exonic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1163826414 19:19527171-19527193 CTGGGGGAAGAGGCGGAGGGGGG - Intronic
1164704788 19:30312279-30312301 CAGGATGAACAGAGGGGGCGGGG + Intronic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165013493 19:32864841-32864863 CTGGCCGTACCGAGGGAGGGTGG - Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165429964 19:35766952-35766974 GTTGGTGAGCCGAGGGAGGGAGG + Exonic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166383284 19:42366587-42366609 TTCGCTGAAGAGAGGGAGGGAGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166830894 19:45639179-45639201 CTGGGGGAACTGCGGGTGGGGGG - Intronic
1166911900 19:46164839-46164861 CTTCGTGAACAGAGGATGGGTGG + Intergenic
1166977142 19:46611297-46611319 CCGGGTGAAGAGAGGAAGGCAGG + Intergenic
1167011873 19:46813818-46813840 CTCGCTGAAAGGAGGGAGGGTGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167307005 19:48715145-48715167 CTGGGAGAAGAGAGGGTTGGGGG + Intronic
1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG + Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167601999 19:50459802-50459824 TTGGGTGAAGAGAGGAAGTGGGG + Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168362111 19:55750521-55750543 TGGGGGGAAGAGAGGGAGGGGGG - Intergenic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925421485 2:3716315-3716337 CTGGGTGATGAGAGACAGGGTGG + Intronic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
925934922 2:8747225-8747247 GTGGGTGAAAAGGGGAAGGGGGG + Intronic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
927471958 2:23384135-23384157 CCGGGGGAGCGGAGGGAGGGTGG + Intergenic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
927928703 2:27030386-27030408 CTGGGAGACCAGTGAGAGGGTGG - Intergenic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930366500 2:50446354-50446376 AGGAGTGAAAAGAGGGAGGGAGG - Intronic
930556259 2:52899216-52899238 CTGGGTGAACCAAGTGAGTGGGG + Intergenic
931470559 2:62534633-62534655 AGGGGGGAAAAGAGGGAGGGTGG - Intergenic
931566025 2:63616369-63616391 CTGGGGGAATTAAGGGAGGGAGG + Intronic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
932418318 2:71586820-71586842 TAGGGTGAGCATAGGGAGGGAGG - Intronic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933747081 2:85579192-85579214 CTGGAGGAAAACAGGGAGGGAGG + Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935635239 2:105244835-105244857 CTGGGTATAAACAGGGAGGGAGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936077161 2:109408844-109408866 ATGGGTGCGCACAGGGAGGGGGG + Intronic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
937016493 2:118610893-118610915 GTGGGTGGGCACAGGGAGGGAGG - Intergenic
937080461 2:119136514-119136536 ATGGGTAAACAGGGGAAGGGCGG - Intergenic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
937679899 2:124632897-124632919 CTGGGGGAAGAGAGGCAGGCAGG + Intronic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938708657 2:133956302-133956324 CGGGGAGAGCAGAGGTAGGGTGG - Intergenic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
940882910 2:158964743-158964765 CTTGCTGAAAAGAGGGAAGGTGG + Intergenic
940887455 2:159001921-159001943 CTGGGTGAAAAGAGGAGGGTTGG + Intronic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941925007 2:170885741-170885763 GTGGGTGACCCGAGGGATGGGGG - Intergenic
941964990 2:171292187-171292209 CTGGGTGGAGAGCTGGAGGGTGG - Intergenic
942134838 2:172914548-172914570 ATGGAGGAAGAGAGGGAGGGAGG + Intronic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
943620832 2:190146149-190146171 CTGGGGGAAGATTGGGAGGGTGG - Intronic
943649947 2:190446583-190446605 TTGGGGGATCAGAGAGAGGGAGG + Intronic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945541897 2:211098269-211098291 GTGGGTGGAGGGAGGGAGGGAGG - Intergenic
945721491 2:213422664-213422686 TTGTGTGTACAGAGGGTGGGAGG - Intronic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
945865278 2:215167641-215167663 GTGGGGGAATAGTGGGAGGGGGG + Intergenic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
947620665 2:231588632-231588654 CTGGGTAAAGATAGGGAGCGGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948613014 2:239181395-239181417 CTGGGTGGGCCGAGGGAGAGGGG + Intronic
948858801 2:240743084-240743106 CTTGGAGAAGAGAGGGTGGGAGG - Intronic
1168925262 20:1574127-1574149 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1168929140 20:1607155-1607177 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1169273604 20:4218558-4218580 CTGGGTTAACCGGGGCAGGGAGG + Intergenic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1170375331 20:15693861-15693883 CGGGGGGAAGAGAGAGAGGGGGG - Intronic
1170533724 20:17319668-17319690 GGGGGTGAACACTGGGAGGGGGG + Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171004876 20:21454527-21454549 ATGGGCTAGCAGAGGGAGGGAGG + Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1171882313 20:30627607-30627629 CTGGGTGAACACCCGCAGGGAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172486406 20:35300597-35300619 CTGGCTGACCTGGGGGAGGGAGG + Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175154539 20:56961198-56961220 CTGGGTGTACAGGAGCAGGGAGG - Intergenic
1175369998 20:58481764-58481786 CTGGGTGGAACGAGGGAGGCTGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817915 20:61893223-61893245 ATGGGTGACCACAGGGATGGTGG + Intronic
1175817938 20:61893306-61893328 GTGGGTGAATAGAGTGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818025 20:61893655-61893677 ATGGGTGAATAGAGGGATAGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176672759 21:9750232-9750254 CTTGGAGAACAGAGGATGGGTGG - Intergenic
1176719573 21:10382170-10382192 CTAGCAGAAGAGAGGGAGGGAGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177047620 21:16190038-16190060 ACGGGGGAAGAGAGGGAGGGAGG - Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178981356 21:37267619-37267641 CCGGGTTAGCGGAGGGAGGGAGG + Intronic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179810575 21:43866575-43866597 TTGGTTGGAAAGAGGGAGGGGGG - Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180182475 21:46124163-46124185 GTGGGTGGACAGAGGATGGGTGG + Intronic
1180300810 22:11035144-11035166 CTAGCAGAAGAGAGGGAGGGAGG + Intergenic
1180316845 22:11283630-11283652 AGGAGAGAACAGAGGGAGGGAGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181455250 22:23055879-23055901 CATGGAGAACAGTGGGAGGGAGG + Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181595247 22:23910244-23910266 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181595254 22:23910278-23910300 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181897147 22:26120396-26120418 AGGGATGAAGAGAGGGAGGGAGG + Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182070102 22:27457515-27457537 CTCAGTGAATAGAGGCAGGGTGG + Intergenic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183064473 22:35353586-35353608 GTGGGTGAACTGAGGAATGGGGG + Intergenic
1183069106 22:35383962-35383984 CAGGTTGAACAGAGGGTGTGGGG + Intronic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183560733 22:38570444-38570466 CTGGGATGACGGAGGGAGGGAGG + Intergenic
1183781302 22:40000752-40000774 ATGGGAGAAAAGAGGGAGGCAGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184350109 22:43937707-43937729 GTGGGTGGACAGGTGGAGGGAGG - Intronic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184878109 22:47288346-47288368 GTGGGTGGATGGAGGGAGGGAGG - Intergenic
1185347040 22:50314982-50315004 CTGGGTGAACGGTGGGAGAGCGG - Intronic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
949327866 3:2887380-2887402 CTGGGTGTGGAGAGTGAGGGTGG + Intronic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950474196 3:13205512-13205534 GTGGATGGATAGAGGGAGGGAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953471491 3:43170398-43170420 GTAGTAGAACAGAGGGAGGGCGG - Intergenic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954610280 3:51941554-51941576 CTGAGGGAACCGAGGGGGGGGGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
956050102 3:65238605-65238627 TGGGGTGAAGACAGGGAGGGAGG - Intergenic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956805738 3:72809205-72809227 GTGGGTGACCAGCGGCAGGGAGG - Intronic
956995164 3:74818769-74818791 TTGGGGGAAGAGTGGGAGGGGGG - Intergenic
957373645 3:79328794-79328816 CTGGGTGAAAGATGGGAGGGGGG - Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
958929247 3:100191336-100191358 GAGGGTGAAGAGAGTGAGGGAGG - Intronic
959592810 3:108098266-108098288 GTGGGAGTTCAGAGGGAGGGAGG - Intergenic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961514537 3:127424522-127424544 GTGTGTGAACAGGGAGAGGGAGG - Intergenic
961514542 3:127424549-127424571 GTGTGTGAACAGGGAGAGGGGGG - Intergenic
961514549 3:127424576-127424598 ATGTGTGAACAGGGAGAGGGAGG - Intergenic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
961802962 3:129466905-129466927 CTGGATGAACAGAGAGAATGAGG + Exonic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964732304 3:159880278-159880300 CTTGGTGAACTGAGGTTGGGCGG - Intronic
965520896 3:169667426-169667448 CTGGGTGACCAGAGCTAGGCAGG + Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966618215 3:181935044-181935066 CTGGATGAAGAGAGAGAAGGGGG + Intergenic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969516013 4:7648626-7648648 CTGGGTCTACTGAGGGCGGGCGG + Intronic
969548455 4:7848069-7848091 GTGGGTGGACGGAAGGAGGGAGG + Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
970488124 4:16544643-16544665 CTGGGAGATAAGAGGGAGTGAGG + Intronic
970813280 4:20122486-20122508 CTGTGTCAACACAGAGAGGGTGG - Intergenic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
972273254 4:37532958-37532980 TGGGGGGAACAGTGGGAGGGGGG + Intronic
972772784 4:42213730-42213752 GAGGGAGAAGAGAGGGAGGGGGG - Intergenic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
976326508 4:83777812-83777834 CTGGGTGAAGATAGGGGTGGAGG + Intergenic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978071628 4:104479778-104479800 ACGGAGGAACAGAGGGAGGGAGG - Intronic
978747382 4:112209415-112209437 CTGGGAGAAAAGTGGCAGGGTGG - Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981837169 4:149067466-149067488 GGGGGGGAATAGAGGGAGGGAGG + Intergenic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984908253 4:184649318-184649340 CTGGGAGAACGCAGGGAGCGGGG + Intronic
985093409 4:186387453-186387475 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985401956 4:189601593-189601615 CTTGGAGAACAGAGGATGGGTGG + Intergenic
985541259 5:488738-488760 TTGGGTGAACGGAGGCAGGTGGG + Intronic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
985648874 5:1098301-1098323 CTGGGTGAGCAGAGGGTTAGAGG - Intronic
985648968 5:1098600-1098622 CTGGGTGAGCAGAGGGTTAGAGG - Intronic
985649003 5:1098709-1098731 CTGGGTGAGCAGAGGGTTAGAGG - Intronic
985649021 5:1098763-1098785 CTGGGTGAGCAGAGGGTTAGAGG - Intronic
985649028 5:1098790-1098812 CTGGGTGAGCAGAGGGTTAGAGG - Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
986684192 5:10261263-10261285 CTGGGTTCCCAGAGTGAGGGAGG + Intronic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
987088214 5:14488292-14488314 CTGGCGGGACAGAGGCAGGGGGG - Intronic
987539553 5:19236424-19236446 TTGGATTACCAGAGGGAGGGGGG + Intergenic
988682357 5:33496305-33496327 ATAGCTGAACACAGGGAGGGTGG - Intergenic
989173239 5:38494323-38494345 CTGGCTGACCAGGGGTAGGGTGG + Intronic
989455946 5:41644509-41644531 GTGGGTGAAAAGTGGGAGGAGGG + Intergenic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
991534750 5:67656000-67656022 ATGGGGTAACAGAGGTAGGGTGG + Intergenic
992084958 5:73270081-73270103 ATGGCAGAACAGACGGAGGGAGG - Intergenic
992484445 5:77181145-77181167 CTGGGTGAATAGACGGAGCGTGG + Intergenic
992626219 5:78637942-78637964 TTGAGTGAACAGTGTGAGGGAGG - Intronic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
997652234 5:135530929-135530951 CTGGATGAAGACAGGGAGTGGGG - Intergenic
997859775 5:137405910-137405932 ATGGGTGAACAGAGGAGAGGTGG - Intronic
998642612 5:144028554-144028576 CTGGGTGAAGAAAGAGAAGGAGG - Intergenic
1000687476 5:164270212-164270234 CTGGCAGGAGAGAGGGAGGGAGG - Intergenic
1000805573 5:165786510-165786532 CTAGGTGAGCAGAGGCAGAGAGG + Intergenic
1001560665 5:172666896-172666918 ATGGGCCAACAGAGGGAGAGGGG - Intronic
1002393834 5:178938076-178938098 TTGGGTGAACAGAAGACGGGAGG + Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003285109 6:4727551-4727573 GTGACTGAACAGAGAGAGGGAGG - Intronic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004240430 6:13916388-13916410 CTGAGGCAACAGAGGAAGGGAGG - Intergenic
1005875097 6:30005300-30005322 CTGAGTGATAAGAGGGACGGAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015695660 6:135977049-135977071 CCTGGTCAACACAGGGAGGGAGG + Intronic
1016317682 6:142808410-142808432 ATGGGTGGACAGAGGCAAGGAGG + Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1018017408 6:159724897-159724919 AGGGGGGAAGAGAGGGAGGGAGG + Intronic
1018211971 6:161490893-161490915 CAGGGGGAAGAGAGAGAGGGAGG - Intronic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018323046 6:162633783-162633805 CAGGATGAAGCGAGGGAGGGAGG + Intronic
1019095375 6:169575285-169575307 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019715333 7:2536206-2536228 CTGGGGGAACTCAGAGAGGGAGG - Intergenic
1019741485 7:2676934-2676956 CTGGGGGAACTCAGAGAGGGAGG + Intergenic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1022251199 7:28610224-28610246 CTGGGTGAACAGTGGGGAGCTGG + Intronic
1023467835 7:40477301-40477323 CTGGGTGGAGTTAGGGAGGGTGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1026020235 7:66700119-66700141 TTGGGTGAAGGGAGGGACGGAGG + Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1026931039 7:74223123-74223145 GTGGCTGGAGAGAGGGAGGGAGG - Intronic
1028424706 7:90673422-90673444 CCTGGGCAACAGAGGGAGGGAGG - Intronic
1028529167 7:91819138-91819160 CTGGGGGAAAAGGTGGAGGGAGG - Intronic
1029714578 7:102318938-102318960 ATGGGGGAACAAAGGGTGGGTGG + Intronic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036632738 8:10526488-10526510 CTGTGTGAACAAGGGGTGGGAGG + Intronic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038015196 8:23508937-23508959 CTGGTTGATTAGAGAGAGGGCGG - Intergenic
1038476937 8:27875206-27875228 AGGAGTGAAGAGAGGGAGGGAGG - Intronic
1038682957 8:29687114-29687136 TTGGGAGAACAGATTGAGGGAGG - Intergenic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1039187264 8:34931153-34931175 GGGAGGGAACAGAGGGAGGGAGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039479211 8:37859265-37859287 CTGGGAGAAGGGTGGGAGGGAGG + Exonic
1039615521 8:38952115-38952137 GTGGCTGCATAGAGGGAGGGAGG + Intronic
1039741583 8:40387907-40387929 CTGGCTGAACAGAGGAGGTGGGG - Intergenic
1040399074 8:47029972-47029994 GTGGGGGGAGAGAGGGAGGGAGG + Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1042383148 8:68142290-68142312 TTGGGTGCAGAGTGGGAGGGAGG - Intronic
1042407717 8:68424116-68424138 GTGGGTGAACATGGGCAGGGGGG - Intronic
1042433839 8:68741080-68741102 GAGGGTGAAGGGAGGGAGGGGGG + Intronic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1044036218 8:87306755-87306777 GTGGGGGAAGAGTGGGAGGGGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047063009 8:121249127-121249149 CTGGGTGAAGAGAGTCTGGGTGG - Intergenic
1047165582 8:122434633-122434655 CTGTGTGAATACAGGCAGGGTGG - Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047574485 8:126137768-126137790 CTGGGGGAAGAGAGTGAAGGGGG + Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048137683 8:131761836-131761858 CTGGGTGAAAACTGGGAGAGGGG + Intergenic
1048151252 8:131896971-131896993 TTGGAGGAAGAGAGGGAGGGAGG - Intergenic
1048440694 8:134457317-134457339 CTGAGAGCACAGTGGGAGGGGGG - Intergenic
1048477094 8:134753262-134753284 TTGGGGGGGCAGAGGGAGGGTGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1049240486 8:141535310-141535332 GTGGGTGACCAGAGGGACTGGGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1049707763 8:144050772-144050794 CTGGGGGATCCGGGGGAGGGCGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050473346 9:6015982-6016004 CTGGGGGAACTGAGGCGGGGAGG - Intergenic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1052977388 9:34421292-34421314 CTGGGGGTACAGAGGTAAGGAGG + Intronic
1053188407 9:36037849-36037871 ATGAGTGCACAGAGGGAGAGAGG + Intronic
1053300117 9:36942985-36943007 CTGGGTGCAGAGAAGGAGAGCGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053450714 9:38192094-38192116 CTGGATGAAGAGAGTGAGTGTGG + Intergenic
1054889045 9:70232355-70232377 TTGGGGGAACAGAAGCAGGGTGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056300063 9:85231445-85231467 TGGGGTGAACAGTAGGAGGGGGG + Intergenic
1057321182 9:94014444-94014466 GTGAGTTAACAGGGGGAGGGAGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060766461 9:126297855-126297877 GTGGCTGAGCAGAGGGCGGGTGG - Intergenic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061046106 9:128166022-128166044 CTGGGTGGATAGGGGAAGGGGGG - Intergenic
1061499047 9:130991813-130991835 GTGTGTGAAAGGAGGGAGGGAGG - Intergenic
1061679573 9:132236281-132236303 GTGGGTTAAAGGAGGGAGGGCGG + Intronic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061887367 9:133598592-133598614 CTGGTGGGAGAGAGGGAGGGAGG + Intergenic
1061932017 9:133838203-133838225 TTGGGTGAATGGTGGGAGGGTGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062357268 9:136170819-136170841 GTGGCTGACCAGAGGGTGGGCGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1062583994 9:137240851-137240873 CTGGGGGCGCCGAGGGAGGGCGG - Intergenic
1062622393 9:137428785-137428807 CTGGGTGGGCAGACCGAGGGAGG + Intronic
1185848563 X:3464098-3464120 GTGGGTGAAGAGTGGGAGGAGGG - Intergenic
1185933296 X:4227477-4227499 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
1185998233 X:4977683-4977705 CTGGGAGAACTGAGGGTGTGAGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186500200 X:10044872-10044894 ATGGGGGGACGGAGGGAGGGAGG - Intronic
1187387366 X:18860928-18860950 CTGGTAGAACAGAGGGTTGGGGG - Intergenic
1187716776 X:22110601-22110623 ATGGCTGCATAGAGGGAGGGGGG - Intronic
1189373986 X:40452047-40452069 CTGCCTGAACCGAGGGAGAGTGG + Intergenic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1191056503 X:56246746-56246768 CTGGCTGAAGATAGGGAGAGAGG + Intronic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1192579175 X:72266769-72266791 TTGGGAGAAAAAAGGGAGGGTGG - Intronic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193534905 X:82702139-82702161 TTGCATGAACAAAGGGAGGGTGG - Intergenic
1195370430 X:104167126-104167148 AGGGGTGAAAATAGGGAGGGGGG - Intronic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1196941301 X:120778690-120778712 TGGGGGGAACAGGGGGAGGGAGG + Intergenic
1197091112 X:122538800-122538822 CTAGGTGAACAGAGGCACTGTGG + Intergenic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200815080 Y:7522722-7522744 GTGGGTGAAGAGTGGGAGGAGGG + Intergenic
1200940071 Y:8771877-8771899 CAGGGTGAAGAGAGGCAGTGAGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic
1201756254 Y:17488968-17488990 TTGGGAGAAAAGTGGGAGGGAGG + Intergenic
1201845298 Y:18417017-18417039 TTGGGAGAAAAGTGGGAGGGAGG - Intergenic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic
1201985892 Y:19964828-19964850 CTCGGGGAACAGTGGGATGGGGG - Intergenic