ID: 1155489845

View in Genome Browser
Species Human (GRCh38)
Location 18:26389742-26389764
Sequence CCCAGTGACCAGAGGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155489845 Original CRISPR CCCAGTGACCAGAGGGTAGT GGG Intronic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
900665294 1:3811061-3811083 CCCAGCCAGCAGAGGGCAGTGGG - Intergenic
900836922 1:5011763-5011785 CCCAGTGGCCAGTGGGTAGTTGG + Intergenic
901494941 1:9615490-9615512 CCCAGTGCCCAGCGGGCAGGAGG + Intergenic
903238105 1:21963821-21963843 CCCAGAGATCAGAGGGGAGCTGG - Intergenic
904163485 1:28537859-28537881 CCCTGTGCCCAGCTGGTAGTTGG - Exonic
905241700 1:36585741-36585763 CCCAGGGCCCAGCGCGTAGTAGG - Intergenic
907498359 1:54860441-54860463 CCCAGTGGCAGGAGGGTTGTAGG - Intronic
907559934 1:55379023-55379045 CCCAGTGGTCAGAGGGTACCAGG - Intergenic
907824585 1:58003196-58003218 CCCAGTCACCAGGGCATAGTAGG + Intronic
908339061 1:63157838-63157860 CACAGTGCCCAGTGGGAAGTTGG + Intergenic
909433418 1:75615541-75615563 CCCACTGCCCAGAGGCTAGGAGG + Intergenic
910463125 1:87469255-87469277 CCCAGGGACCACAGGGGATTTGG + Intergenic
914451683 1:147798372-147798394 CACAGTGCTCAGAGGATAGTTGG - Intergenic
915217500 1:154349829-154349851 ACCCATGAGCAGAGGGTAGTGGG + Exonic
917513590 1:175688565-175688587 CCCAGGAAGCAGAGGGCAGTGGG + Intronic
918125384 1:181579257-181579279 CCCAGTTAACAGAGGGGAGAAGG - Intronic
918332664 1:183474037-183474059 CCCAGTGACCACAGGACAGTTGG + Intronic
919011928 1:191975811-191975833 CCTAGTGACCTGAGAGTAGTTGG + Intergenic
920548437 1:206837953-206837975 CCCAGTGCTCAGAGGGGATTAGG + Intronic
920866629 1:209758815-209758837 CAAAGTGACCAGAGGGTTCTAGG + Exonic
922719611 1:227893561-227893583 CCCATTGCCCACAGGCTAGTGGG + Intergenic
923406391 1:233665396-233665418 CCGAGTGAACAGAAGGTACTAGG - Intronic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064103131 10:12480061-12480083 CCCAGTGACCAGAGATGTGTGGG - Intronic
1064283507 10:13971817-13971839 GCCAGGGACCAGAGGGTTGGCGG - Intronic
1066629988 10:37449858-37449880 CGAAGTGACCAGGAGGTAGTTGG - Intergenic
1067551026 10:47236647-47236669 CCCAGTGCCCTGAGGGTTCTGGG - Intergenic
1069535547 10:69250157-69250179 CTCATAGACCAGAGGGTCGTGGG - Intronic
1069800873 10:71080752-71080774 GTCAGTGAGCAGAGGGTATTAGG - Intergenic
1072799769 10:98384908-98384930 CCCAGTCCCCACAGGGTAGTGGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073216516 10:101839766-101839788 CCCAGTCACCAGCTGGTAGAGGG + Intronic
1073476366 10:103756512-103756534 CCCAGTGCCCAGAGGCTCCTGGG + Intronic
1073542417 10:104324602-104324624 CCCAGTGGCCACAGGGTGGCAGG - Intronic
1074782012 10:116808938-116808960 CCCAGTGGCTAGCGGGGAGTGGG + Intergenic
1076097350 10:127742402-127742424 CCCAGTGACCAAAGGTTTCTAGG - Intergenic
1076249322 10:128972742-128972764 CCCAGAGAGCAGAGTGGAGTTGG - Intergenic
1077015582 11:397725-397747 CTCAGTGAGCAGAGGACAGTGGG - Intronic
1078050807 11:7963348-7963370 CCCACTGGCCAGAGGGGAGTTGG - Exonic
1079622046 11:22567051-22567073 CCTAGTGAAGAGTGGGTAGTGGG + Intergenic
1081182326 11:39999051-39999073 CCCAATGAACAGAGGCTAGAAGG - Intergenic
1082229136 11:49742617-49742639 CCCAGTGACCCATGGGTACTGGG + Intergenic
1082555598 11:54559581-54559603 CCCAGGAACCTGAGGGTACTGGG + Intergenic
1083749470 11:64753415-64753437 CCCAGAGACCAGAGAGTGGTCGG + Intronic
1084168218 11:67387021-67387043 CCCAGGGGCCAGAGGGTCGGGGG + Intronic
1086620949 11:88886525-88886547 CCCAGTGACCCATGGGTACTGGG - Intronic
1089557647 11:119323419-119323441 CCCAGCCACCAGAGGGATGTGGG + Intergenic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1095378919 12:41565772-41565794 CCCAGTGTCCTGAGGGAAATAGG - Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103455577 12:121062777-121062799 CCCAGTGCCCAGCACGTAGTAGG - Intergenic
1104274114 12:127309137-127309159 CCCACTGACCACAGGCTAGTGGG + Intergenic
1104375943 12:128266119-128266141 CCCAGTCACAAGGGGGGAGTCGG + Intergenic
1107390366 13:39956899-39956921 CACAGTGCCTAGAGGTTAGTAGG - Intergenic
1112217504 13:97448669-97448691 CCCAGTGACCAAATTGTGGTTGG + Intronic
1115080011 14:29438736-29438758 CCCAGTTAACAGAGAGTAGGAGG + Intergenic
1116865027 14:50024944-50024966 CCCAGTTACCAGTGGGTAGAAGG + Intergenic
1119740723 14:77012256-77012278 CCCGGTGTCCAGAGGGGAGCTGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1126308277 15:47286252-47286274 CCCAGTGTGCAGAGGGTCTTAGG + Intronic
1128636045 15:69303085-69303107 CCAAGAGATCAGAGTGTAGTAGG + Intronic
1130095035 15:80849538-80849560 GCCAGTGACCTGAGGGTTCTCGG + Intronic
1131015847 15:89057424-89057446 CACAGTGACCACTGGGAAGTTGG + Intergenic
1132399821 15:101498418-101498440 GGCAGTGACAGGAGGGTAGTGGG + Intronic
1132931885 16:2462831-2462853 CCCAGGGACCAGATGCAAGTTGG + Intronic
1133262637 16:4561344-4561366 AGCAGTGACCAGAGGAGAGTGGG + Intronic
1138341584 16:56292997-56293019 ACCACTGACCACAGGGGAGTTGG - Intronic
1139711646 16:68780796-68780818 GCAAGTGACATGAGGGTAGTTGG + Intronic
1140266807 16:73428218-73428240 CCCAGTGACCCCAGGGTCGGGGG + Intergenic
1141659033 16:85431732-85431754 CCCAGGGCCCAGAGGGTATCTGG + Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142234236 16:88914276-88914298 CGCAGTGACCAGAGGGGGATCGG + Intronic
1144023956 17:11261203-11261225 CCTAGTTGCCAGAGGGTACTGGG + Intronic
1146054819 17:29575775-29575797 CCCAGTGCCCACAGGGTGGCTGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150584514 17:66505310-66505332 CCCTGTGGCCAGAGGTTGGTGGG - Intronic
1151556063 17:74847300-74847322 CTCAGTGACAAGAAGGTTGTGGG - Exonic
1152048963 17:77958293-77958315 CCCAGGGACCGGAGGGCAGGCGG + Intergenic
1152307721 17:79531017-79531039 CCCAGCGACCTTAGGGTAGAGGG - Intergenic
1152630730 17:81409683-81409705 GCCACTGACCAGAGGGAAATCGG + Intronic
1153255463 18:3165981-3166003 CACAGTGGGCAGTGGGTAGTAGG - Intronic
1153770192 18:8409036-8409058 CCCAGTGAGCAGAGGCTAGGAGG - Intergenic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1156339624 18:36199787-36199809 CCCAGGGCCCAGAGAGCAGTGGG + Exonic
1158130015 18:54142165-54142187 CCCTGTGACCTGAAGGTATTGGG + Intergenic
1158658408 18:59361927-59361949 CTCAGGCACTAGAGGGTAGTAGG - Intergenic
1159593045 18:70355588-70355610 CCCATTGAGGAGAGAGTAGTTGG + Intergenic
1159653580 18:71005362-71005384 CCCAGAGACCAGTGGATAGCAGG - Intergenic
1162529806 19:11229290-11229312 CCCACTGTGCAGAAGGTAGTGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1164753321 19:30671625-30671647 CTCAGTGACCAGAGGTGAGGAGG + Intronic
1166080474 19:40441172-40441194 CCCAGTGGTCACAGGGGAGTGGG + Exonic
1167169626 19:47822460-47822482 CCCAGTGCCCAGCGTGTGGTTGG + Intronic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
928868776 2:35950176-35950198 TCCAGAAACCAGAGGGTACTGGG + Intergenic
930990933 2:57653617-57653639 CATAGAGACCAGAAGGTAGTGGG - Intergenic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
936051254 2:109225468-109225490 CCCAGTCCCCAGTGGGGAGTCGG - Intronic
936562670 2:113555107-113555129 CACAGTGAGCAGAGGATATTGGG + Intergenic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
946128729 2:217587560-217587582 CCAAGTGACATGAGGGAAGTTGG - Intronic
949026927 2:241770664-241770686 CCCAGGGTCCAGAGGGCACTAGG - Intergenic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1172481845 20:35276117-35276139 CCCAGAGACCACAGGGTCGGGGG - Exonic
1172593450 20:36133239-36133261 CCCAAATACCAAAGGGTAGTTGG - Intronic
1173263036 20:41453230-41453252 CCCAGTGACCAAAGTGGTGTCGG + Intronic
1173914366 20:46695911-46695933 CCCAGTGACTAGTGGGTGGAAGG - Intergenic
1174123802 20:48287988-48288010 CCCAGTGCCTAGAGGGAGGTGGG + Intergenic
1174476871 20:50801928-50801950 CTCAGTGACCACAGGGGTGTGGG + Intronic
1174919126 20:54683138-54683160 CCCAGTGAGCAGGGGTCAGTGGG - Intergenic
1175907403 20:62387574-62387596 CGCAGTGAGCAGAGGGGACTTGG - Intronic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1179538281 21:42066695-42066717 CCCAGTGACCAGGTGGTTCTGGG + Intronic
1179614762 21:42575270-42575292 CCCAGTGACAAGATTGTTGTGGG + Intronic
1180582664 22:16855730-16855752 CCCTGTGACCAGCAGGTATTGGG + Intergenic
1180876273 22:19176653-19176675 CCCAGTGATCAGAGGGTTCATGG + Exonic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1185402623 22:50626734-50626756 CCCACTGAACTGAGGGTAGTGGG + Exonic
950577050 3:13838225-13838247 CCCAGGGCCCAGAGGGACGTGGG + Intronic
950936175 3:16841975-16841997 CCCAGTGGTCAGAGGGAAATGGG + Intronic
954755663 3:52838191-52838213 CCCAGTGAGCAGAGGGTTTGGGG - Exonic
955306871 3:57842104-57842126 GACAGTGACCTGAGGGTAGGAGG + Intronic
958873285 3:99586797-99586819 CCTAGTGAACAGAGCTTAGTGGG + Intergenic
961387408 3:126530282-126530304 CCCAGGGGCCAGTGGGTAGAAGG - Intronic
961443606 3:126967406-126967428 CCCAGTGACCTGAGGGAAAACGG - Intergenic
964009676 3:151876894-151876916 CACAGTGACCAGCAGATAGTAGG - Intronic
964478597 3:157120215-157120237 CCCAGAGACCAGAGGGGCCTTGG - Intergenic
967853332 3:194098302-194098324 CTCACTGACCACAGGGCAGTGGG + Intergenic
968172098 3:196518874-196518896 CCCAGTGACCCATGGGTATTGGG - Intergenic
969196684 4:5568863-5568885 CCCAGTGACTTGAGAGCAGTTGG - Intronic
969436793 4:7193279-7193301 ACCAGTGACCAGAGGCCAGTAGG - Intronic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
983102238 4:163639017-163639039 CCCAGAGACTGGAGGGCAGTGGG + Intronic
983107530 4:163707932-163707954 CCCAGTAAGCAGAGCTTAGTAGG - Intronic
985811707 5:2094890-2094912 CCCAGTCACCAGACGGTGGGTGG + Intergenic
987038524 5:14040655-14040677 CCCAGGGAACAGAGGGCACTTGG + Intergenic
987396642 5:17430686-17430708 CCCAGGAACCAGAGGGTTGGGGG + Intergenic
994997331 5:107080245-107080267 ACCAATGACCTGAGGGTAGAGGG - Intergenic
995716319 5:115084740-115084762 CCCAGTGACCCATGGGTATTCGG + Intergenic
997823905 5:137089476-137089498 GCCAGTGACCTGAGGGCAGTGGG + Intronic
997855290 5:137367779-137367801 CCCAGTTATCAGCAGGTAGTTGG - Intronic
999610346 5:153362458-153362480 CCCAGTGAGTAGAGGGGAGTGGG + Intergenic
1002593272 5:180305610-180305632 CCCAGTGACCAGAGGACCATGGG + Intronic
1003030562 6:2597086-2597108 CTCAGTGACCAGAGGCAGGTTGG - Intergenic
1006828714 6:36955919-36955941 CCCAGTCACCTGAGGGTGGCTGG - Intronic
1008600047 6:53084215-53084237 ACCAGTGACCACAGGGAATTAGG + Intronic
1009461589 6:63920347-63920369 GCAAGAGACCAGAGGGTAGGAGG + Intronic
1011845677 6:91560646-91560668 CCCAGGCCCCACAGGGTAGTGGG + Intergenic
1012445121 6:99299266-99299288 GACAGTGACCAGTGGGAAGTGGG - Intronic
1013015263 6:106155248-106155270 CCCAGTCACCTGAGGATAATGGG - Intergenic
1015749945 6:136549947-136549969 ACCAGTGGCCAGAGAGTCGTCGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017399527 6:154044175-154044197 CTCAGTGACAGGAGGGTATTAGG - Intronic
1019692419 7:2423727-2423749 CTCAGTGTACAGAGGGTGGTGGG - Intronic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1022523553 7:31023009-31023031 CCCAGTGACCAGGAGGTCATGGG + Intergenic
1023277481 7:38535491-38535513 TCCACTGACCAGAGGGTGGCGGG + Intronic
1034016602 7:147594285-147594307 CCAAGATACCAGAGGGTAGCTGG - Intronic
1034936241 7:155202727-155202749 CTCAGTGGCCAGAGGTTAGGGGG + Intergenic
1040877121 8:52165676-52165698 CCCAGTAACCAAATGGCAGTGGG - Intronic
1042102163 8:65285120-65285142 CCCTGTGACCAGAGAGTACAGGG - Intergenic
1047141020 8:122139925-122139947 CCCACTGACCTGAGGGGTGTGGG - Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1049890063 9:60590-60612 CACAGTGAGCAGAGGATATTGGG - Intergenic
1051816512 9:21113371-21113393 CACAGAGGCCAGAGGGTAGTGGG + Intergenic
1053360974 9:37486392-37486414 CCCAGTGAAGAGAGGGAAATGGG - Intronic
1053731540 9:41061866-41061888 CACAGTGAGCAGAGGATATTGGG - Intergenic
1054696971 9:68370229-68370251 CACAGTGAGCAGAGGATATTGGG + Intronic
1055197911 9:73619419-73619441 TCCAGTACCCAGAGGGCAGTAGG - Intergenic
1056837608 9:89969887-89969909 TCCAGTAACCACAGGGCAGTAGG + Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1058982116 9:110179741-110179763 CTCAGTGATCAGAGGGTATTGGG + Intergenic
1060189142 9:121581236-121581258 CCCAGAGCCAAGGGGGTAGTGGG + Intronic
1060728433 9:126021684-126021706 CCCAGTCATGAGAGGCTAGTGGG - Intergenic
1060908495 9:127329628-127329650 GCCAGTGATCAGGTGGTAGTAGG + Intronic
1061379354 9:130244772-130244794 CCCAGTGGCCACAGGGCAGCAGG + Intergenic
1190278551 X:48914493-48914515 CCCAGTGACCAGACAGTGGCCGG + Exonic
1195742143 X:108075652-108075674 CCCAGTGACCAGAGTGCATGAGG + Intronic
1198039085 X:132831539-132831561 GGCAGTGTCCAGAAGGTAGTTGG - Intronic
1199528362 X:148818856-148818878 CCCAGAGACCACAGGCTAATGGG + Intronic