ID: 1155491352

View in Genome Browser
Species Human (GRCh38)
Location 18:26404926-26404948
Sequence GGTTGTGTACGTGCACGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155491352_1155491355 -2 Left 1155491352 18:26404926-26404948 CCCATTCGTGCACGTACACAACC No data
Right 1155491355 18:26404947-26404969 CCACCTTCGTCCATCTGATTTGG No data
1155491352_1155491358 9 Left 1155491352 18:26404926-26404948 CCCATTCGTGCACGTACACAACC No data
Right 1155491358 18:26404958-26404980 CATCTGATTTGGTCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155491352 Original CRISPR GGTTGTGTACGTGCACGAAT GGG (reversed) Intergenic
No off target data available for this crispr