ID: 1155491481

View in Genome Browser
Species Human (GRCh38)
Location 18:26405540-26405562
Sequence CCAAGCAGCTTGGCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155491474_1155491481 12 Left 1155491474 18:26405505-26405527 CCTCTGGAGCGGAAAGTCTGGAA No data
Right 1155491481 18:26405540-26405562 CCAAGCAGCTTGGCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155491481 Original CRISPR CCAAGCAGCTTGGCAGAGCC TGG Intergenic
No off target data available for this crispr