ID: 1155492332

View in Genome Browser
Species Human (GRCh38)
Location 18:26411540-26411562
Sequence CTTTGAAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155492332_1155492338 -8 Left 1155492332 18:26411540-26411562 CCTTCCACCTTGGCCTTTCAAAG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
Right 1155492338 18:26411555-26411577 TTTCAAAGTGCTGGGATTGCAGG 0: 12
1: 1167
2: 28071
3: 323003
4: 258859
1155492332_1155492341 25 Left 1155492332 18:26411540-26411562 CCTTCCACCTTGGCCTTTCAAAG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
Right 1155492341 18:26411588-26411610 CGTGCCCATTTCTTGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155492332 Original CRISPR CTTTGAAAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr