ID: 1155493776

View in Genome Browser
Species Human (GRCh38)
Location 18:26423598-26423620
Sequence TTTCCACCAAGTGGCCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155493771_1155493776 -7 Left 1155493771 18:26423582-26423604 CCAGTGCCTTCCAGAATTTCCAC No data
Right 1155493776 18:26423598-26423620 TTTCCACCAAGTGGCCCCGGAGG No data
1155493770_1155493776 1 Left 1155493770 18:26423574-26423596 CCTTAAGTCCAGTGCCTTCCAGA No data
Right 1155493776 18:26423598-26423620 TTTCCACCAAGTGGCCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155493776 Original CRISPR TTTCCACCAAGTGGCCCCGG AGG Intergenic
No off target data available for this crispr