ID: 1155494022

View in Genome Browser
Species Human (GRCh38)
Location 18:26425308-26425330
Sequence GGTTAGGGATGAGCGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155494013_1155494022 3 Left 1155494013 18:26425282-26425304 CCCTCCTCCCTTTCTTGAAAGTG 0: 1
1: 0
2: 6
3: 33
4: 475
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494015_1155494022 -1 Left 1155494015 18:26425286-26425308 CCTCCCTTTCTTGAAAGTGAGTG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494017_1155494022 -4 Left 1155494017 18:26425289-26425311 CCCTTTCTTGAAAGTGAGTGGTT 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494014_1155494022 2 Left 1155494014 18:26425283-26425305 CCTCCTCCCTTTCTTGAAAGTGA 0: 1
1: 0
2: 3
3: 40
4: 478
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494012_1155494022 6 Left 1155494012 18:26425279-26425301 CCTCCCTCCTCCCTTTCTTGAAA 0: 1
1: 0
2: 6
3: 62
4: 745
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494011_1155494022 24 Left 1155494011 18:26425261-26425283 CCTAATAACTCACTCTCTCCTCC 0: 1
1: 0
2: 2
3: 34
4: 340
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data
1155494018_1155494022 -5 Left 1155494018 18:26425290-26425312 CCTTTCTTGAAAGTGAGTGGTTA 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1155494022 18:26425308-26425330 GGTTAGGGATGAGCGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155494022 Original CRISPR GGTTAGGGATGAGCGGTTGC AGG Intergenic
No off target data available for this crispr