ID: 1155498352

View in Genome Browser
Species Human (GRCh38)
Location 18:26464221-26464243
Sequence CCTTCCTTCTGGAGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 1, 1: 25, 2: 174, 3: 628, 4: 1817}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155498352 Original CRISPR CCTTCCTTCTGGAGGCTCTG GGG Intronic
Too many off-targets to display for this crispr