ID: 1155498417

View in Genome Browser
Species Human (GRCh38)
Location 18:26464655-26464677
Sequence TAGGTGCCAGATGCCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155498413_1155498417 0 Left 1155498413 18:26464632-26464654 CCCATTTCATTTTAAAAACTGTG 0: 1
1: 2
2: 7
3: 66
4: 702
Right 1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 121
1155498414_1155498417 -1 Left 1155498414 18:26464633-26464655 CCATTTCATTTTAAAAACTGTGT 0: 1
1: 4
2: 8
3: 116
4: 994
Right 1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155498417 Original CRISPR TAGGTGCCAGATGCCGTGGA AGG Intronic
900804670 1:4759620-4759642 TAGGTGGGAGAAGCCATGGAAGG - Intronic
900888188 1:5430192-5430214 TGGGTGTCAGATGCTTTGGAGGG - Intergenic
902992580 1:20199514-20199536 TTGATGCCAGATGCCTTGGCTGG - Intergenic
906816258 1:48882777-48882799 TAGTTGCCAGAGGCTGGGGATGG - Intronic
907809973 1:57859401-57859423 TATGTGCCAGATGCCGTAATAGG + Intronic
913317005 1:117561974-117561996 TAAGTGCCAGATGCCCTGCTGGG + Intergenic
915493522 1:156265451-156265473 TAGCTTCCAGAAGCCCTGGAGGG + Intronic
916745764 1:167683840-167683862 TGGGTACCAGATGCCATGCAAGG - Intronic
917120964 1:171644310-171644332 AAGGGGCCAGATGCAGGGGAGGG - Intronic
917957573 1:180116120-180116142 TATGTGCCAGATACTGTGGTTGG + Intergenic
920264134 1:204709247-204709269 TAGGTGCCAGATGTTGGGGGAGG + Intergenic
920666364 1:207965482-207965504 TATGTGCCAGATGCTGTGCAGGG + Intergenic
922653974 1:227364818-227364840 TAGGTGGCAGAAGCAGTGGGAGG + Intergenic
924092176 1:240512944-240512966 TATGTGCCAGGTGCAGTGGTGGG + Intronic
1064030786 10:11881281-11881303 TATGTGCCAGATGCCATGCTAGG - Intergenic
1066954429 10:42150631-42150653 TAGGGGCAAGAAGCCGTGGCAGG + Intergenic
1067931856 10:50569909-50569931 TAGGTGCCAGATGCAGTCTTGGG - Intronic
1069745101 10:70710043-70710065 CAGGGGCCAGATGCTGGGGATGG + Intronic
1070923903 10:80205554-80205576 CAGGTGCCAGAGGCAGTGCAAGG + Exonic
1075645502 10:124093438-124093460 TAGGTGCCAGACGCCGAGGTGGG - Intronic
1077485129 11:2835031-2835053 TAGGAGCCAGAAGCGGGGGAGGG + Intronic
1078656463 11:13245225-13245247 TATGTGCCAGGTGCTGTGCATGG + Intergenic
1079991270 11:27249244-27249266 TAGGTGCCAAATGCCCTTTAAGG + Intergenic
1080343552 11:31296166-31296188 TATGTGCCAGATTCTGTGCAAGG + Intronic
1081844464 11:46229370-46229392 TGGGTGCCAGGGGCTGTGGAGGG + Intergenic
1085465211 11:76718604-76718626 CGGATGCCTGATGCCGTGGATGG - Intergenic
1086835077 11:91610942-91610964 TAGGTCCCAAATTCCCTGGAGGG + Intergenic
1087577301 11:100005129-100005151 TATGTGCCAGGTGCTGTGGTAGG - Intronic
1088273823 11:108063205-108063227 TAGTTGCCAGATGCTGGGTAGGG - Intronic
1089482753 11:118820517-118820539 TGGGTGACAGATGACGTGGCCGG + Intergenic
1090513487 11:127399826-127399848 TAGGTGCCAGATCAAGTGCAAGG - Intergenic
1091095345 11:132815925-132815947 TGGGTGCTAGATGCAGAGGAAGG + Intronic
1091380296 12:53795-53817 TGGGTGCCTGATGCCGTGGAAGG + Intergenic
1093211167 12:16310956-16310978 TAGGTGCCAGGTGCCCTGCTAGG + Intergenic
1095965563 12:47864800-47864822 TTGGTGTCAGAGGCCCTGGAAGG - Intronic
1100112484 12:91262207-91262229 TATGTGCCAGATGACATGAAAGG - Intergenic
1101562412 12:105870197-105870219 TATGTGCCAGATGCTGAGCAAGG - Intergenic
1102927920 12:116840708-116840730 TGGGTGACAGATGACATGGAGGG - Intronic
1103519135 12:121526018-121526040 TTGGTGCCAGATGATGTGGGGGG - Intronic
1104870299 12:131990327-131990349 GAGGTGCTTCATGCCGTGGAGGG + Intronic
1105323913 13:19353023-19353045 TAGGTTCCAGATGCCCTCAAGGG + Intergenic
1107426231 13:40295876-40295898 CAGGGGCCAGATGCAGTGTAGGG - Intergenic
1108067625 13:46594575-46594597 TAGGTGCCAAGTGCCCTGGAAGG + Intronic
1113761083 13:112847006-112847028 TGGATGCCAGAGGCTGTGGACGG - Intronic
1115050530 14:29055763-29055785 TAGTTACCAGATGCTGGGGAGGG - Intergenic
1118639359 14:67777936-67777958 TAGGTGCCAGATGGGGCGGCTGG - Intronic
1122279208 14:100611178-100611200 TCGCTGCCAGCTGCCGTGGGGGG + Intergenic
1128240966 15:66100729-66100751 TATGTGCCAGATGCTGTGCTGGG + Intronic
1128259463 15:66222430-66222452 TAGGTGCAAGAGGCTGTGGGTGG - Intronic
1132694656 16:1196514-1196536 TAGGGGCCAGAAGCAGTGGCGGG - Intronic
1135525960 16:23213744-23213766 TAGGTGCCAGGTGCTGTGTGAGG + Intronic
1137871299 16:51953067-51953089 TAGGTGCCAGACTCCGTGCCAGG + Intergenic
1137943752 16:52714342-52714364 TCGGTGGAAGATGCCGTGCAGGG - Intergenic
1140699559 16:77568734-77568756 TCTGTGCCTGATGCTGTGGATGG - Intergenic
1141597504 16:85106375-85106397 TAAGTCCCCGATGCCTTGGAAGG - Intronic
1141670957 16:85491479-85491501 TATGTGCCAGATGACTTGGGGGG + Intergenic
1142143691 16:88483711-88483733 TAGGTGCCAGGTGCCGTTCCAGG - Intronic
1147397757 17:40158005-40158027 TGGGTGACAGAGGCAGTGGAAGG + Intronic
1149023183 17:51993891-51993913 TAAGTGCCAGATGCTGTGATGGG + Intronic
1150488318 17:65559243-65559265 TGGGAACCAGATGCCGGGGAAGG - Intronic
1152635276 17:81428304-81428326 TGGGAGCCAGATGCTGTGGCTGG - Intronic
1152938652 17:83154412-83154434 TGGGTCCCAGAGGCCCTGGAAGG - Intergenic
1152983778 18:303936-303958 TAGGAGCCAGATGCTGTGCTAGG + Intergenic
1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG + Intronic
1156767270 18:40672530-40672552 TAGGAGCCAGATACGATGGAAGG - Intergenic
1160813456 19:1024315-1024337 TAGGTGTCAGCTGCCGTGGCCGG - Intergenic
1161658041 19:5527952-5527974 GAGGTGACATATGCCCTGGAAGG + Intergenic
925889032 2:8418944-8418966 TATGTGCCAGATGCCGCAAAAGG + Intergenic
926921541 2:17945510-17945532 TGGGTGCCAGATGCAGTGCCAGG + Intronic
928546357 2:32332599-32332621 TAGAGGCCAGATGCTGTGCAAGG + Intergenic
929759594 2:44796159-44796181 TATGTGCCAGATGCTGTGGGAGG + Intergenic
930300284 2:49607040-49607062 TATGTGCCAGATGCTGTGCTAGG - Intergenic
931443561 2:62308175-62308197 TAGATGCCAGGTGCCCTGCAAGG + Intergenic
935388283 2:102524109-102524131 TATGTGCCAGGTGCTGTGGAAGG - Intronic
937957350 2:127428786-127428808 CAGGAACCAGGTGCCGTGGAAGG - Exonic
938119776 2:128625334-128625356 TAGGTGTCAGATATCTTGGAAGG - Intergenic
943343390 2:186708392-186708414 TATGTGCCAGATACCATGCATGG + Intronic
944340902 2:198597732-198597754 TAAGTGCCAGAAGGCGGGGATGG + Intergenic
945600958 2:211864251-211864273 TAAGGGCCAGATGCCAAGGATGG - Intronic
946640222 2:221775861-221775883 TATGTGCCAGACACTGTGGAAGG + Intergenic
946641069 2:221783920-221783942 TATGTGCCAGGTACCATGGATGG - Intergenic
947299075 2:228667772-228667794 TACGTGCCAGATGCAGTGTCAGG - Intergenic
1176209372 20:63910596-63910618 TGGGTGCCCGATGCCCAGGAGGG + Intronic
1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG + Intronic
1178214116 21:30574195-30574217 TATGTGCCAGATGCTTTGGTAGG - Intergenic
1182103820 22:27674953-27674975 TAGGTGCCAGATGCTGTGTTTGG - Intergenic
1182358927 22:29735354-29735376 CAGGTGGCAGATCCCCTGGAAGG + Intronic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950650921 3:14406144-14406166 TAGGAGCCAGATGGTGGGGAGGG + Intronic
955341696 3:58130114-58130136 AAGGTGCCAGCTGCATTGGAGGG + Intronic
955451010 3:59066472-59066494 TAGATGCCAGATGCTGTGTTAGG + Intergenic
955765939 3:62344015-62344037 TAGGTGCCAGATACTGTGATGGG - Intergenic
956266629 3:67403831-67403853 CAGGTGCCAGATGCCAGGGATGG + Intronic
959953507 3:112209275-112209297 TAACTGCCAGAGGCCTTGGAGGG - Intronic
961499112 3:127318459-127318481 TTGGTGCCAGATGCAGTGCTTGG + Intergenic
967088928 3:186118745-186118767 TAAGTGCCAGGTGCTGTGGTTGG - Intronic
967588820 3:191247685-191247707 TATGTGCCAGATGCTGTGCTTGG - Intronic
967769125 3:193314525-193314547 TAGTTTCCAGATCCCGTGGATGG - Intronic
968967479 4:3776439-3776461 TAGGTGCCAGAGGAGGTGGACGG - Intergenic
969465992 4:7356770-7356792 TAGGTGCCAGGTGCCCTGTAAGG - Intronic
971931026 4:33083080-33083102 TATGTGCCAGGGGCCGAGGACGG - Intergenic
973081974 4:46003970-46003992 TGGGTGACAGATGTCCTGGAAGG - Intergenic
977490918 4:97709970-97709992 TAGGTGCCAGATTCTGTGGGTGG + Intronic
979658868 4:123229174-123229196 TAAGTGCCAAGTGCTGTGGAAGG + Intronic
985427370 4:189843909-189843931 CAGGTTTCAGATGCAGTGGAGGG - Intergenic
986354906 5:6914159-6914181 CAGGTGACAGAGGCTGTGGAGGG + Intergenic
987776723 5:22376277-22376299 TAGATGCAAGATGCTGTGAAGGG + Intronic
990488176 5:56279346-56279368 GAGGTGCCTGAAGCTGTGGAAGG + Intergenic
996361088 5:122647629-122647651 TAGTTACCAGATGCTGTGAAGGG + Intergenic
997034626 5:130174869-130174891 CTGGAGCCAGATGCCATGGATGG - Intronic
1001564779 5:172692749-172692771 TGGGTGCCAGATGCTGTGCCTGG - Intergenic
1003308300 6:4947737-4947759 TAGGTGCCAGCGTCCATGGAAGG + Intronic
1005308248 6:24534159-24534181 GAGCTGGCAGATGCCGGGGAGGG - Exonic
1011813101 6:91155571-91155593 TTGGTGGCATATGCCGTAGATGG - Intergenic
1015489976 6:133813913-133813935 TAGGTGCCAGATACCATAGAAGG - Intergenic
1019514241 7:1432783-1432805 TAGGAGCATGACGCCGTGGAGGG - Intronic
1023119591 7:36895855-36895877 TATGTGCCAGATGCTGTGGTAGG + Intronic
1024095227 7:45977446-45977468 TGGGTGCCGGGTGCGGTGGATGG + Intergenic
1028358954 7:89944660-89944682 TAGGTGCAAGATACAGTGAAGGG + Intergenic
1031079676 7:117246296-117246318 TAGTTGCCAGAGGCTGGGGAGGG + Intergenic
1035608117 8:942554-942576 GAGCTGCCAAATGCCGTGAAAGG - Intergenic
1038445277 8:27599537-27599559 TAGCTGACAGATGACTTGGACGG - Intronic
1044072426 8:87778628-87778650 TAGGTGCCAATGGCAGTGGATGG - Intergenic
1047967126 8:130054484-130054506 TAAGTGCTAGATGCCAAGGATGG + Exonic
1048352839 8:133629884-133629906 TAGGAGCCGCATGCCTTGGATGG + Intergenic
1049224328 8:141442420-141442442 TAGTTGCCAGGTACCATGGATGG + Intergenic
1049519653 8:143081351-143081373 CAGGTGCCAGGTGCCGGGGAAGG + Intronic
1050413335 9:5388865-5388887 TATGTGCCAGATGCTGTTGTAGG - Intronic
1051435560 9:17027225-17027247 TAGCTGCCAGAGGCTGGGGAGGG - Intergenic
1054787749 9:69225044-69225066 TAGGTCCCTGATCCAGTGGAGGG - Intronic
1057565007 9:96159920-96159942 TAGTGGCCAGAGGCCCTGGAGGG - Intergenic
1058551071 9:106115695-106115717 TATGTGCCAGTTGCCGTGCTAGG + Intergenic
1061976564 9:134070910-134070932 TAGGTGCCAGATACTGTTGAAGG - Intergenic
1203563540 Un_KI270744v1:75977-75999 AAGGTGCCAGCAGCCGTGGGTGG + Intergenic
1188438911 X:30194944-30194966 TAGGTGCCAGATGATTTGGTAGG + Intergenic
1193822981 X:86188942-86188964 CATGTGCTAGATGCTGTGGAGGG - Intronic
1195705806 X:107737281-107737303 CAGGTGCCAGTTGCCAGGGAGGG - Intronic
1199612505 X:149630699-149630721 TATGTGCCAGATACGGTGGGTGG + Intronic