ID: 1155504946

View in Genome Browser
Species Human (GRCh38)
Location 18:26524180-26524202
Sequence CCTGCTTTCCAGCAGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155504934_1155504946 27 Left 1155504934 18:26524130-26524152 CCTACCCATAACAACTGGATTAG 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 207
1155504940_1155504946 -9 Left 1155504940 18:26524166-26524188 CCAGGCACACATTGCCTGCTTTC 0: 1
1: 0
2: 1
3: 43
4: 410
Right 1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 207
1155504936_1155504946 23 Left 1155504936 18:26524134-26524156 CCCATAACAACTGGATTAGGATC 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 207
1155504939_1155504946 -4 Left 1155504939 18:26524161-26524183 CCTCACCAGGCACACATTGCCTG 0: 1
1: 0
2: 1
3: 13
4: 237
Right 1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 207
1155504937_1155504946 22 Left 1155504937 18:26524135-26524157 CCATAACAACTGGATTAGGATCT 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155504946 Original CRISPR CCTGCTTTCCAGCAGGGGTA GGG Intronic
900330164 1:2130270-2130292 CCTGCTTTCCAGCTGGGGACTGG + Intronic
900419023 1:2547587-2547609 CGGGCTTTCCAGCAGGGGCCAGG - Intergenic
901039878 1:6357492-6357514 CCAGCTTTCCAGCTGAGGTGAGG - Intronic
903307445 1:22423232-22423254 CATGCTTTGCACCAGGAGTAGGG + Intergenic
905341902 1:37283991-37284013 CCTGATTTCCAGAAGGGAAAAGG - Intergenic
905881689 1:41468178-41468200 ACTGCTTTCCTGCAGGTGTCAGG + Intergenic
906069889 1:43008650-43008672 CCTGCTTTCAAGCTGGAGCAGGG + Intergenic
907288402 1:53396763-53396785 CCTGCTTCCCAGCAGGGCTATGG + Intergenic
908051124 1:60231926-60231948 CCTGACTTTCAGCTGGGGTAAGG - Intergenic
910646882 1:89524426-89524448 ACTGCTTTCCAGAAGCGGGAGGG - Intergenic
911661759 1:100509190-100509212 CCTCCTTTCCATCAGGAGTTGGG + Intronic
912094568 1:106121912-106121934 CATGTGTTCCAGCAGGGGTGGGG - Intergenic
912497400 1:110100431-110100453 CTTGGTTTCCAGCTGTGGTATGG - Intergenic
912718382 1:111999304-111999326 CCAGCTTTTCTGCAGGGGTCTGG - Intergenic
913502281 1:119482326-119482348 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
913517582 1:119617585-119617607 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
915118145 1:153612968-153612990 CCTCCTCTCCAGCAGGGCTCTGG + Intronic
915456201 1:156042319-156042341 CCAGATTTCCTGCAGTGGTAGGG - Intronic
915593742 1:156884779-156884801 CAAGCTGCCCAGCAGGGGTAGGG + Intergenic
919295864 1:195699078-195699100 CTTGCTTTCCAGCCTGGGCATGG - Intergenic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
921353113 1:214257845-214257867 GCTGCTGTGCAGCAGGGGTCGGG - Intergenic
922668506 1:227492057-227492079 CCTGCTTTGAAGCAGGGGATAGG + Intergenic
924041025 1:239983991-239984013 CCTAGTTGCCAGCAAGGGTAAGG - Intergenic
1063210905 10:3880410-3880432 CCTGCTTTATGGCAGGGGCAAGG + Intergenic
1063428087 10:5965257-5965279 CATGGTGTCCAGCAGGGGTGAGG - Intronic
1063662593 10:8044458-8044480 TCTCCTCACCAGCAGGGGTAGGG + Intergenic
1065180517 10:23120052-23120074 CCTTCTTTTGAGCAGGGATAAGG + Intronic
1065900305 10:30200320-30200342 CCTGCTTTCCATCACTGTTATGG - Intergenic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067421415 10:46153669-46153691 ACTACTTTCCAGCTGAGGTAGGG - Intergenic
1067506753 10:46860128-46860150 ACTACTTTCCAGCTGAGGTAGGG - Intergenic
1067567025 10:47346740-47346762 CAGGCTTCCCAGCAGGGCTAAGG + Intergenic
1067571179 10:47372311-47372333 CCTGCATTCAAGCATGGGCAGGG - Intronic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075780177 10:125012329-125012351 CCTGCTTCCCAACACGGGGACGG + Intronic
1076384774 10:130048232-130048254 CCTGCTGTCCTGCAGCTGTAGGG - Intergenic
1076427054 10:130374269-130374291 CCTACTTTCCAACAGGACTAGGG + Intergenic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1076821792 10:132943260-132943282 GCTGCTTTCCGGCCGGGGTCCGG + Intergenic
1077393492 11:2310318-2310340 CCTGCTCTCCAGGAAGGGAAGGG + Intronic
1081150700 11:39627285-39627307 CCTGCTTTCCAGCTGAGGTGGGG - Intergenic
1081762125 11:45584030-45584052 AATGGTTTCCAGCAGGGGGAGGG - Intergenic
1081862643 11:46342270-46342292 TCTGCTTTCCAGGTGGGGTGGGG - Intronic
1083104730 11:60346853-60346875 CCTGCTTTTCAGCTGCGGTGAGG + Intronic
1083966477 11:66046842-66046864 CCTGGGTCCCAGGAGGGGTAAGG + Intronic
1085220739 11:74871908-74871930 CCTGCTTTTCAGCTGCGGTTAGG - Intronic
1086949864 11:92880799-92880821 CCTCCATTCCGGCAGGGGTTTGG - Exonic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1090892616 11:130939084-130939106 CCTGCTTTGCTGCCAGGGTATGG - Intergenic
1091341119 11:134814726-134814748 CCTGATTTCCAGCTGGGGTGGGG + Intergenic
1092281585 12:7101742-7101764 GTTGCTTGCCAGCAGGGGCAGGG + Intronic
1095947098 12:47759470-47759492 ACTGCTCTCCAGAACGGGTAGGG + Intronic
1096075987 12:48805120-48805142 CCTGTTTGCCAGGATGGGTATGG - Intergenic
1096148527 12:49295008-49295030 CCTGCTGTTCCGCAGGGGTGGGG + Exonic
1096467633 12:51856129-51856151 CCTGCTTTCCATCTGGGGAAAGG - Intergenic
1096669524 12:53190285-53190307 CATGCTGGCCAGCAGGGGTCGGG - Exonic
1097020984 12:56020785-56020807 CCTCCTTTCCAGCAGTGAGAGGG - Intronic
1097077811 12:56408239-56408261 CCTGCTTTTCAGCAGTGTTCAGG + Intergenic
1097130481 12:56807549-56807571 CCTGCTTTTCAGCGGTGGTCAGG + Intergenic
1097475411 12:60049401-60049423 CCTTCTTTCAATCAGAGGTAAGG + Intergenic
1099139668 12:78956472-78956494 TTTTCTTTCTAGCAGGGGTAGGG - Intronic
1100813356 12:98362195-98362217 CCTTCTTCCCAGCCAGGGTAGGG + Intergenic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1104308536 12:127633164-127633186 GCTGGTTTCCAGCAAGGGGAGGG - Intergenic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1106606220 13:31231693-31231715 CTTGGTTTACAGCAGGGATAAGG + Intronic
1111394525 13:87648037-87648059 CTTGGTTTCCAGCATGAGTATGG + Intergenic
1111984392 13:95051181-95051203 CCTGCTTTCCAGCAACTGTGGGG - Intronic
1113262089 13:108575869-108575891 CCTAATTTCCAGCAGGTGAATGG + Intergenic
1113637121 13:111927274-111927296 CCTGCCTGCCTGCAGAGGTACGG - Intergenic
1115313767 14:32005579-32005601 AATGCTCACCAGCAGGGGTAAGG + Intergenic
1118711356 14:68522230-68522252 CCTCCTTTCCAGCAGCAGAAAGG - Intronic
1121685890 14:95834760-95834782 GCTGCTTTCCAGGAGGGAAATGG - Intergenic
1122272027 14:100572572-100572594 CCTCCCCTCCAGGAGGGGTAAGG - Intronic
1122658949 14:103281655-103281677 CTTCCTTTCCAGCAGAGGGAGGG - Intergenic
1122664468 14:103319095-103319117 CCTGTTTTTCAGCAGTGGGATGG - Intergenic
1123033657 14:105463023-105463045 CCTGCCTGCCAGCAGGGGCCTGG + Intronic
1202897902 14_GL000194v1_random:20642-20664 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124317190 15:28680627-28680649 CCTGCTCAGCAGCAGGGGTTGGG - Intergenic
1125341275 15:38677923-38677945 CCTGCTACCCAGTGGGGGTAGGG - Intergenic
1128010130 15:64286021-64286043 CATGCTTTCCAGCAGTGCTGAGG + Intronic
1129703177 15:77779778-77779800 CTTGCTTTCCAGTAGGGCTGGGG - Intronic
1129832617 15:78680664-78680686 CCCGCTTTCCAGCAGGTGCAAGG - Intronic
1130512275 15:84599961-84599983 CCTGTTTTCAAGCAGGGTTGGGG + Intergenic
1131540891 15:93274379-93274401 CCTGCTAACCAGCTGGGGGAGGG + Intergenic
1132578859 16:676089-676111 CTCGCTTTCCAGGATGGGTAGGG + Intronic
1132783502 16:1641792-1641814 CCTGCTTTACAGCTTGGGGAAGG + Intronic
1133235050 16:4383874-4383896 CCTGCTTTCCTCCAGGGACAGGG + Intronic
1134824224 16:17271756-17271778 CCTGGTTCCCAGCAGGGGTCGGG - Intronic
1135064093 16:19294900-19294922 CCTGCCTTCCATCTGGGGCAGGG + Intronic
1135166287 16:20141922-20141944 CTAGCTTTCAAGCAGGGGTCTGG - Intergenic
1136984003 16:35083180-35083202 CCTGCTTGCCAGCAGGCAGATGG + Intergenic
1138547354 16:57727758-57727780 CCTGCTCTCCAGCACAGGGAGGG + Intronic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1141158478 16:81612981-81613003 GCTGCGTTCCAGCTGGGGGAAGG - Intronic
1142984902 17:3689747-3689769 CCCACTTTACAGCAGGGGAAGGG + Intronic
1143874513 17:9981642-9981664 CCTGCTTGGCAGCAGGCCTAAGG + Intronic
1144613410 17:16745912-16745934 CCGGCTTTCCAGAAGGAGTGAGG - Intronic
1144714887 17:17427042-17427064 CCTGCTTTCCAGTGGTGGTCAGG - Intergenic
1146271917 17:31490208-31490230 CCTGCCTACCAGGAGGGGAAGGG - Intronic
1148223467 17:45881705-45881727 ACTGCTTTACAGCAGGGGAGGGG - Intergenic
1148719765 17:49743198-49743220 CCTGGTTTCTAGCAAGGGAAAGG - Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150587958 17:66535483-66535505 CCTGTTTGGCAGCAGGGGTGGGG - Intronic
1151336213 17:73441166-73441188 GCTGCTTTACAGGAGGGGTGGGG - Intronic
1151863867 17:76786765-76786787 CCTGCTTTCCTTCTGGAGTACGG - Intergenic
1151951084 17:77354514-77354536 CCTCCTTTCCAGCTGGGGGAGGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154996598 18:21646558-21646580 ACTGCATTCCAGCCTGGGTAAGG - Intergenic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1156426664 18:37020698-37020720 ATTGCTTTCCAGAAGGTGTATGG + Intronic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1156991236 18:43410503-43410525 CAGGCTGTCCAGCAGGGCTATGG + Intergenic
1157324823 18:46661223-46661245 CCTCCTTTCCAGCAAGGCTGTGG - Intergenic
1158058259 18:53307864-53307886 ATTGCTTTCCAGAAGGGTTATGG - Intronic
1158375507 18:56858861-56858883 CCTGCCTTCTTGCAGGGGGAAGG + Intronic
1161804692 19:6435981-6436003 CCTGCATTCCAGCCTGGGGAGGG + Intergenic
1162099255 19:8329943-8329965 CCTGCTTTGCAGCAAGGATTAGG + Intronic
1163519683 19:17784549-17784571 CCAGGTTTCCAGCAGGGGGCAGG - Intronic
1163720052 19:18894562-18894584 CCTCCTGTCCCGCAGGGGTGGGG + Intronic
1164062123 19:21684632-21684654 CCTGCTTTTCAGCTGTGGTTGGG - Intergenic
1164187572 19:22884130-22884152 CCTGCTTTTCAGCTGTGGTTGGG - Intergenic
1165905561 19:39192527-39192549 CCCTCTCTCCAGCAGGGGGATGG - Intergenic
1166230831 19:41425209-41425231 CCTGCTGTCCAGCAGAGTGATGG + Intronic
924964121 2:59713-59735 CCTGCTTTTCAGCAGTGGTGAGG - Intergenic
927662702 2:25006258-25006280 CCTGATTTCGAACAGGGGCATGG + Intergenic
927927208 2:27022200-27022222 CTTGCTTTCCAGCTGGGGTATGG + Exonic
928071651 2:28223284-28223306 CCTGCTTTCCAGCTGGTTTGGGG + Intronic
929313426 2:40451395-40451417 CCTGTTTTCCAGCGGGCGTTGGG - Intronic
932887815 2:75562718-75562740 CCAGCTTTCCAGCAGGCATATGG + Intronic
935682829 2:105652673-105652695 CCTGCTTCCCAGGAGTGGTTTGG + Intergenic
938450985 2:131419769-131419791 ATTGCTTTCCAGCAGTGGGAAGG - Intergenic
938981799 2:136534170-136534192 CCTGCCTTCCAGTAGGGGAGTGG + Intergenic
942838416 2:180329416-180329438 CCTGTTCTCCAGCAGAGGAAAGG - Intergenic
943441476 2:187932648-187932670 CCTGCTTTTCAGCAGTAGTCAGG + Intergenic
946614469 2:221494787-221494809 ACTGCATTCCAGAAGGGGCAGGG + Intronic
947829273 2:233127174-233127196 GCAGCTTTCCAGGAGGGGTTAGG + Intronic
948693895 2:239723062-239723084 CCTGCTTTCCAGCTGGCAGAAGG + Intergenic
1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG + Intergenic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1174008357 20:47428441-47428463 CATGCTTTGTAGCAGGGGTTGGG + Intergenic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1176617584 21:9036631-9036653 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1176707560 21:10127039-10127061 CCTGCTGTTCACCTGGGGTATGG + Intergenic
1179174809 21:39000675-39000697 CCTGCTTTGCAGCAGAGCCAGGG - Intergenic
1180015586 21:45080829-45080851 CCTGCTTTCCTCTGGGGGTAGGG - Intronic
1180975926 22:19848400-19848422 GCTGCTTTCCTGCTGGGGGAAGG - Exonic
1181446916 22:22984124-22984146 CATGGTTTCCAGCAGGGTCAGGG - Intergenic
1181511526 22:23391305-23391327 CCTGATGTCCAGCAGGTGTGAGG + Intergenic
1181985564 22:26797971-26797993 ACTGCATCCCAGCAGGGGTAGGG + Intergenic
949363828 3:3259466-3259488 CCTGTTCTCCTGCAGGGATAAGG + Intergenic
950645484 3:14374289-14374311 CCGTCTCTCCAGCTGGGGTAGGG + Intergenic
952711949 3:36440407-36440429 CCTGCTGTCCTGCAGGCATAAGG - Intronic
954442822 3:50531013-50531035 CCTTCTTCTCAGAAGGGGTAGGG + Intergenic
954720249 3:52555423-52555445 CATTCTTACCAGCAGTGGTAAGG - Intronic
956092185 3:65679733-65679755 ACTGTTTTCCAACAGGGGTGGGG + Intronic
956273103 3:67468935-67468957 CCTGCCTTCAATCAGGTGTAAGG + Intronic
957402776 3:79737946-79737968 GCTGGTTTCCAGCGGGAGTATGG - Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
961106224 3:124243885-124243907 CCTACTTTCAAGCAAGGGAAGGG - Intronic
962169720 3:133088181-133088203 ACAGCTATCCAGCAGTGGTAGGG + Intronic
964320745 3:155494349-155494371 CCTGCGTTCCAGTAGGGGAGAGG + Exonic
964687429 3:159412758-159412780 ACTGCTTTCCTGCAGGGCCAGGG - Intronic
968615440 4:1575610-1575632 GCGGCTGTCCAGCAGGGGGAGGG + Intergenic
970436782 4:16043513-16043535 CGTCCTTTCCAGCAGGGGCCTGG - Intronic
971878768 4:32340557-32340579 CCTGAATTCCAGCTGGGGGAGGG - Intergenic
978451695 4:108840727-108840749 CCTTCTTTCAAGCAGGGTTGAGG + Intronic
981919726 4:150074617-150074639 ACTGCTTTTCAACAGGGGTAGGG - Intergenic
986700059 5:10397963-10397985 TCTCCTTTCCAGAAGAGGTAAGG + Intronic
990333989 5:54754735-54754757 TCTTCTTCCCAGCAGGGGTGTGG + Intergenic
995231630 5:109771626-109771648 CCTGCTTTCTAGCTAGGGTTGGG + Intronic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
1000121588 5:158203138-158203160 CCTGCTCTCCAGCTGGGCTTTGG + Intergenic
1001473646 5:172033841-172033863 CCTACTGTCCAGGAGGGGTGTGG + Intergenic
1001825615 5:174742809-174742831 CCTGCTCTCCTGGAGGGGTTGGG - Intergenic
1002235591 5:177800392-177800414 CCTGGTTTCTACCTGGGGTATGG - Intergenic
1002347541 5:178558191-178558213 CCTGCCTTCCATCAGGAGTGGGG - Intronic
1006356281 6:33560362-33560384 CCTGCTTTCCATCAGGAGGAAGG + Intergenic
1006887327 6:37393533-37393555 CCTTCTTTACAGCAGGGCTCTGG + Exonic
1007665487 6:43510651-43510673 CCTGGATTCCGGCGGGGGTATGG - Exonic
1007944712 6:45815769-45815791 CCTGCTAGCCAGCAGAGGGATGG + Intergenic
1009477421 6:64110895-64110917 CCTGTGTTACAGCAGGGCTAGGG + Intronic
1010010233 6:71040424-71040446 CCTCCTTTCCTCCAGGGCTAAGG + Intergenic
1014866704 6:126540839-126540861 CCTCCATTTCTGCAGGGGTATGG - Intergenic
1017861554 6:158403195-158403217 CCTGCTTTCAAGCAGAGCTCGGG - Intronic
1019179923 6:170180083-170180105 CCAGCTTCCCAGCCTGGGTAAGG - Intergenic
1022889095 7:34677586-34677608 CCAGTTTTCCAGCAGGTGGAAGG - Intronic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1024623932 7:51188265-51188287 TCTGTTCTCCAGCAGTGGTAGGG + Intronic
1024983106 7:55173859-55173881 ACTGCTTTCCAGCATGGTGAGGG + Intronic
1028658770 7:93242274-93242296 CTTACATTCAAGCAGGGGTAAGG + Intronic
1029439283 7:100578309-100578331 CCTGCTTTCTGGCAGGAGGATGG - Intronic
1033141191 7:138828209-138828231 CCTGCTTTACTGCAGTGGTCTGG + Intronic
1034254553 7:149717360-149717382 CCTGCTTGCCAGGAGGGCTCAGG - Intronic
1036983230 8:13494911-13494933 CCTGCACTCCAGCCTGGGTAAGG + Intronic
1037059147 8:14485272-14485294 ACTGCATTCCAGCGGGGGCAGGG - Intronic
1039505185 8:38046948-38046970 CCTGCCTCCCAGCAGGGCAAGGG - Intronic
1039823559 8:41154622-41154644 CATGTTTTCCAGGTGGGGTAAGG + Intergenic
1043726305 8:83615291-83615313 AATGCTTTCCTGCAGGGATAAGG - Intergenic
1044008460 8:86964443-86964465 CCTGCTTTTCAGCAGTGGTCAGG + Intronic
1046129898 8:109954309-109954331 GCAGCGTTCAAGCAGGGGTAGGG + Intergenic
1049522996 8:143104177-143104199 CCTGCTAGCCAGTAGGGGTGAGG - Intergenic
1049523006 8:143104239-143104261 CCTGCTAGCCAGGAGGGGTGAGG - Intergenic
1049799758 8:144512317-144512339 CATGCTTTCCGGCAGGTGTGCGG - Exonic
1051776117 9:20635992-20636014 CCTCCTTCAAAGCAGGGGTATGG - Intergenic
1053076856 9:35140911-35140933 CCTGCTTTGCAGCATTGGTCAGG - Intergenic
1053644756 9:40113776-40113798 CCTGCTGTTCACCTGGGGTATGG + Intergenic
1053761229 9:41351075-41351097 CCTGCTGTTCACCTGGGGTATGG - Intergenic
1054325775 9:63711656-63711678 CCTGCTGTTCACCTGGGGTATGG + Intergenic
1054350003 9:64012620-64012642 CCTGCTGTTCACCTGGGGTATGG - Intergenic
1054539820 9:66262193-66262215 CCTGCTGTTCACCTGGGGTATGG - Intergenic
1054934156 9:70668933-70668955 CCGACTTCCCAGCAGGGCTATGG - Intronic
1057938193 9:99258116-99258138 CCTGCCTTCCAGGAGGGCTTGGG - Intergenic
1059959298 9:119549827-119549849 GCTGCTTACCAGCATGGGAAGGG - Intergenic
1060741264 9:126099043-126099065 CCTTCTTCCAGGCAGGGGTAAGG + Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1202792306 9_KI270719v1_random:95919-95941 CCTGCTGTTCACCTGGGGTATGG + Intergenic
1193070469 X:77300709-77300731 CCTGTTTTTCAGCAGGGATCTGG - Intergenic
1193560751 X:83013426-83013448 CCTGTTTTTCAGCAGCGGTTAGG + Intergenic
1194296239 X:92129736-92129758 ACTTCTTTCCTTCAGGGGTAGGG + Intronic
1197161323 X:123325904-123325926 CCTGCTTTCCATAATGGATAAGG + Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1200613747 Y:5354343-5354365 ACTTCTTTCCTTCAGGGGTAGGG + Intronic
1200747529 Y:6915736-6915758 CCTCCTATCCAGCAGGAGTGGGG - Intronic
1201150975 Y:11095469-11095491 CCTGCTGTTCACCTGGGGTATGG - Intergenic