ID: 1155507829

View in Genome Browser
Species Human (GRCh38)
Location 18:26549170-26549192
Sequence GCCCGCTGCGCCCTGGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 288}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155507829_1155507837 -3 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507837 18:26549190-26549212 GGCGAGGCTTGGGAGCGGGATGG 0: 1
1: 0
2: 3
3: 27
4: 356
1155507829_1155507836 -7 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507836 18:26549186-26549208 AGCGGGCGAGGCTTGGGAGCGGG 0: 1
1: 0
2: 1
3: 16
4: 241
1155507829_1155507843 12 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507843 18:26549205-26549227 CGGGATGGGGCTGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 118
4: 988
1155507829_1155507842 9 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507842 18:26549202-26549224 GAGCGGGATGGGGCTGGCGGCGG 0: 1
1: 0
2: 4
3: 71
4: 788
1155507829_1155507841 6 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507841 18:26549199-26549221 TGGGAGCGGGATGGGGCTGGCGG 0: 1
1: 0
2: 10
3: 101
4: 1111
1155507829_1155507844 15 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507844 18:26549208-26549230 GATGGGGCTGGCGGCGGCGGCGG 0: 1
1: 1
2: 16
3: 197
4: 1540
1155507829_1155507840 3 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507840 18:26549196-26549218 GCTTGGGAGCGGGATGGGGCTGG 0: 1
1: 1
2: 4
3: 45
4: 631
1155507829_1155507835 -8 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507835 18:26549185-26549207 CAGCGGGCGAGGCTTGGGAGCGG 0: 1
1: 0
2: 1
3: 26
4: 268
1155507829_1155507838 -2 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507838 18:26549191-26549213 GCGAGGCTTGGGAGCGGGATGGG 0: 1
1: 0
2: 1
3: 6
4: 155
1155507829_1155507839 -1 Left 1155507829 18:26549170-26549192 CCCGCGGCCAGGGCGCAGCGGGC 0: 1
1: 1
2: 3
3: 26
4: 288
Right 1155507839 18:26549192-26549214 CGAGGCTTGGGAGCGGGATGGGG 0: 1
1: 0
2: 3
3: 16
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155507829 Original CRISPR GCCCGCTGCGCCCTGGCCGC GGG (reversed) Exonic
900100384 1:959917-959939 CCCCGCGGCGCCCTTGTCGCGGG - Intergenic
900103008 1:970857-970879 GCCCTCTCTGCCCTGCCCGCAGG + Exonic
900187226 1:1338088-1338110 CCCGGCTGCCCCCTGGCCTCTGG - Exonic
900349280 1:2227314-2227336 CCCCGCTGCGCCGTGGCCGGTGG - Intergenic
900717774 1:4156318-4156340 GCCACCTGCGTCCTGGCCTCTGG + Intergenic
900735602 1:4297722-4297744 GCCCGCTGCAGCCTGGCCCCTGG - Intergenic
900970859 1:5991921-5991943 GCCCCCTGCCCCCTGCCCCCTGG - Intronic
901194492 1:7432897-7432919 GCTGGCTGGGCCCTGGCTGCAGG - Intronic
901205966 1:7496091-7496113 GCCCTCTGGGTCCTGGCGGCTGG - Intronic
901812613 1:11776497-11776519 GCCCACTGCACCCAGGCCACAGG - Exonic
902522595 1:17029007-17029029 GCCAGCAGCGCCCAGGCCTCTGG - Intronic
903683301 1:25112025-25112047 GCCCGCAGTGCCCTGCCTGCTGG - Intergenic
904030960 1:27533178-27533200 GCCAGCTAGGCCCTGGCCTCAGG - Intergenic
904031655 1:27536966-27536988 GCCTCCTGCTGCCTGGCCGCAGG - Intronic
904617294 1:31756700-31756722 GCCTGCTCTGCCCTGGCCTCGGG - Exonic
905179131 1:36155965-36155987 GCCCGCTCGGCCGTGGCCGTGGG + Intronic
905354656 1:37372933-37372955 GAACGATGCGCCCGGGCCGCCGG - Intergenic
905684802 1:39900990-39901012 GCCCGCCGCCCCCTGTCCGCTGG - Exonic
906078377 1:43068329-43068351 GCCCGCGGGGCGCTGGGCGCGGG + Intergenic
906244128 1:44261267-44261289 GCGCTGTGCGCCCTGCCCGCTGG - Intronic
906491441 1:46271776-46271798 GCCCGCTGCTACATGGCCCCAGG - Intronic
908605519 1:65793164-65793186 GGCCGCAGCGCTCTGGACGCCGG - Intronic
908951537 1:69568109-69568131 GCCCGCTGCGCCCTGGCCCCTGG + Intergenic
910237135 1:85048076-85048098 GCCCTCTGAGCCCTGGCCACAGG + Intronic
911449569 1:98046056-98046078 GGCCGCTGCCCCCCTGCCGCTGG + Intergenic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
912559207 1:110538164-110538186 GCCTGCAGGGCCCTGGCAGCCGG + Intergenic
915142947 1:153778187-153778209 GCCCGCTGCCCACTGCCAGCCGG - Exonic
915322411 1:155063041-155063063 CCCCGCTCCGCCCTGGCTCCTGG - Intergenic
915517484 1:156421638-156421660 GCCCGCTGAGCCCCGGCATCTGG - Intronic
916651647 1:166839574-166839596 CCACCCCGCGCCCTGGCCGCTGG + Intronic
919070669 1:192751420-192751442 GCCCCCTGCTCCCTGGCACCTGG + Intergenic
920370020 1:205473013-205473035 GCCCGCTGTGCCCTCTCCTCTGG - Intergenic
923171444 1:231421475-231421497 CACCGCCGAGCCCTGGCCGCCGG + Exonic
923549956 1:234955599-234955621 GCCCTCTGCCCCCTGCCCCCAGG - Intergenic
924423629 1:243931607-243931629 AGCCGCTGCGCCCTCCCCGCGGG + Intergenic
1064418284 10:15168829-15168851 GCCGGCCCCGCCCTGCCCGCCGG + Intergenic
1065637453 10:27745626-27745648 GGCCCCTGCGCCCTGGGCGCCGG - Intronic
1067436876 10:46284710-46284732 GCCCGCGACGCCCTACCCGCCGG - Intergenic
1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG + Intergenic
1067582193 10:47452776-47452798 TCCCTCTCCGCCCTGGCCGGTGG - Intergenic
1067596873 10:47565476-47565498 GGTCGCTGGGCCCGGGCCGCCGG - Intergenic
1069995160 10:72337301-72337323 GTCCACTGGACCCTGGCCGCCGG - Intronic
1072680085 10:97499573-97499595 GCCAGCGGCGCCCTCGCCCCCGG - Intronic
1073057222 10:100710387-100710409 GCCTGGGGCGCCCTAGCCGCTGG + Intergenic
1074814498 10:117134299-117134321 GCCCGCTGGGCCCGGGGCGGCGG + Exonic
1075022232 10:118960406-118960428 GCCCTCCCCGCCCTGGCCCCAGG + Intergenic
1076838365 10:133032506-133032528 GCCCTCTGCGCCCAGGCCTCTGG - Intergenic
1077051449 11:568673-568695 CCCCGCCGCGCCCTCGCAGCTGG - Intergenic
1077053149 11:576696-576718 GCCTGCGCCGCGCTGGCCGCGGG + Intronic
1077089055 11:770097-770119 GCGGGCTGCCCCCTGGCCCCAGG - Exonic
1077151511 11:1075019-1075041 GCCCGCCTCGCCCTGCCCCCAGG - Intergenic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1077223403 11:1427153-1427175 GCCGGCAGCGCCCTGCCCCCAGG - Intronic
1077327380 11:1969597-1969619 GCCCGCCGGGTCCTGGCCTCAGG - Intronic
1077334897 11:1998854-1998876 GCCTGCTGAGCACTGACCGCCGG + Intergenic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1083160801 11:60852987-60853009 GCACGAAGCGGCCTGGCCGCCGG + Exonic
1083617930 11:64035683-64035705 CCGCGCTGCGCACTGGCCGGCGG - Intronic
1083747648 11:64744658-64744680 GCCCGCGCCGCCCTGGGCGGGGG + Intronic
1083901771 11:65646789-65646811 GCGCGCGGCGCCCGGGGCGCGGG + Exonic
1083929544 11:65833356-65833378 GCTTGGGGCGCCCTGGCCGCGGG + Intronic
1084518991 11:69651312-69651334 GCCGGCTCCGCCCTCGCTGCGGG - Exonic
1084891742 11:72240127-72240149 GCCCGCCGCGCCCTTGGCGCTGG + Exonic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085641646 11:78196657-78196679 GCCACCTGCGCGCAGGCCGCGGG - Exonic
1086590410 11:88508824-88508846 GCCGCCTGCGCCCCTGCCGCGGG + Exonic
1088401230 11:109423737-109423759 GCCTACTGCGCCTGGGCCGCGGG - Exonic
1090670524 11:128942208-128942230 GCCCGCTGTGCCCAGGACCCAGG + Intronic
1202810362 11_KI270721v1_random:24777-24799 GCCCGCCGGGTCCTGGCCTCAGG - Intergenic
1202817880 11_KI270721v1_random:54036-54058 GCCTGCTGAGCACTGACCGCCGG + Intergenic
1091586638 12:1820699-1820721 GCCCACTGCGCTCTGCCTGCCGG + Exonic
1092155381 12:6278751-6278773 CCCGGCCGCGCCCTGGCCGCCGG - Intergenic
1096475617 12:51907286-51907308 GCCCGCAGCTCCCGGGTCGCTGG - Intronic
1102018303 12:109663386-109663408 GCCCGCTGTCCCCTTGCCTCTGG + Intergenic
1103363861 12:120368913-120368935 GCCCCCTGCGCCCTGGCGCCCGG - Intronic
1103960799 12:124607957-124607979 TCACTCTGCGCCCTGGCCACGGG - Intergenic
1104267149 12:127244270-127244292 CCCAGCTGCTCCCTGCCCGCAGG - Intergenic
1104570928 12:129924996-129925018 GCCCACTGCTCTCTGGCCACCGG - Intergenic
1104642735 12:130477879-130477901 GCCAGCTGCACTCTGGCCACAGG + Intronic
1104906959 12:132218689-132218711 GCCCACTGCGCCCTGGGAGATGG - Intronic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1109024719 13:57142823-57142845 GCCCGCTGCTCCTGGGCCTCAGG + Exonic
1109025706 13:57149393-57149415 GCCCGCTGCTCCTGGGCCTCAGG + Exonic
1109026696 13:57155966-57155988 GCCCGCTGCTCCTGGGCCTCAGG + Exonic
1109027688 13:57162537-57162559 GCCCGCTGCTCCTGGGCCTCAGG + Exonic
1109028674 13:57169102-57169124 GCCCGCTGCTCCTGGGCCTCAGG + Exonic
1109029308 13:57173467-57173489 GCCCGCTGCTCCTGGGCCTCAGG + Intergenic
1109062069 13:57632458-57632480 GCACGCTGCGCCAGGGCCCCAGG + Exonic
1109152068 13:58858887-58858909 GCCCCCTGCTCCCTGGCGCCCGG - Intergenic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112580637 13:100674387-100674409 GCCGGGTGCGCCCGGGCCGAGGG + Intronic
1113880690 13:113623879-113623901 GCCCTCTGCGTCCTTGCCGGTGG + Intronic
1114088840 14:19267156-19267178 GCCACCTCCGCCCTCGCCGCCGG + Intergenic
1115203327 14:30875391-30875413 GCCCGCTGAGCGCCGGCAGCAGG + Intronic
1119438475 14:74612656-74612678 TCCGCTTGCGCCCTGGCCGCTGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119787017 14:77321329-77321351 GCGTGCTGCGCGCTGCCCGCTGG + Intronic
1121743577 14:96270485-96270507 GCCCGCTGGGCCCTGGTGACAGG + Intergenic
1122268175 14:100556430-100556452 GCCCGCTTTGCCCTGGCCCTGGG - Intronic
1122904586 14:104795843-104795865 GCGCGCTCCGCCCTCGCCGCCGG - Intergenic
1122969825 14:105147983-105148005 GCCCCCTGCCCCCTGCCCCCGGG - Intronic
1122982825 14:105199302-105199324 GCCAGCGGGGGCCTGGCCGCAGG - Intergenic
1124496163 15:30188614-30188636 TCCTGCTGTGCACTGGCCGCAGG - Intergenic
1124692739 15:31839103-31839125 GCCAGGTGAGCCCTGGCCTCAGG + Intronic
1124747411 15:32350033-32350055 TCCTGCTGTGCACTGGCCGCAGG + Intergenic
1126451261 15:48811382-48811404 GACTGCTGCACCCTGGCCGAAGG - Intergenic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1131290146 15:91100179-91100201 GCGCGCTGCGCCTGGGCGGCTGG + Intronic
1132513430 16:354817-354839 CCCCGCTGGGTCCTGGCCGCAGG + Intergenic
1132613418 16:828832-828854 GCCTGCTGCTCCGGGGCCGCTGG + Intergenic
1132642371 16:983670-983692 GCCCACTGTGCCCTCGGCGCAGG - Intronic
1132953937 16:2581100-2581122 ACCCTCTGGGCCCAGGCCGCAGG + Intronic
1132960408 16:2619063-2619085 ACCCTCTGGGCCCAGGCCGCAGG - Intergenic
1136428680 16:30184994-30185016 GCCCCCTTCTCCCTGGCCCCAGG - Intronic
1136498772 16:30659459-30659481 GCCCGAAGCGGCCTGTCCGCAGG - Exonic
1137531755 16:49282386-49282408 GCGCCCTGCACCCCGGCCGCCGG - Intergenic
1138351102 16:56346697-56346719 GACAGCTGCGTCCTGGCAGCAGG - Exonic
1139917989 16:70439681-70439703 GGCCGCTGCGCCCTGGCCTGAGG + Intergenic
1140478792 16:75251637-75251659 GCCGGCTGGGCCGTGGCGGCAGG - Intronic
1141079234 16:81036041-81036063 GCCCGCTGTCCCCGCGCCGCCGG + Exonic
1141980599 16:87547693-87547715 CCCTGCTGCCCCCTGGCCTCTGG - Intergenic
1142136414 16:88453759-88453781 CCCCGCTCTGCCCTGGGCGCCGG + Intronic
1142250328 16:88989045-88989067 GCCCGCTGGGAGCTGGCTGCTGG + Intergenic
1142672227 17:1492504-1492526 GGCCGCGGTGCCCAGGCCGCTGG - Exonic
1143139175 17:4731293-4731315 GCCCGCTGCGCCTCAGCCACAGG - Intergenic
1143967926 17:10770211-10770233 GCCCGCTGCTCACTGTCCGAGGG + Intergenic
1144338998 17:14297574-14297596 GCCCTTCGCGCCCGGGCCGCTGG + Intergenic
1144493911 17:15735468-15735490 TCCCGCTGTGCCCTGGTCACAGG + Intronic
1144695929 17:17303799-17303821 TCACGCTCAGCCCTGGCCGCAGG - Exonic
1144729868 17:17520142-17520164 GCCCCCTCCCTCCTGGCCGCTGG + Intronic
1144906350 17:18641211-18641233 TCCCGCTGTGCCCTGGTCACAGG - Intronic
1145881748 17:28357411-28357433 GCCCGGCGGGCCCTGGCCGTGGG - Exonic
1146281968 17:31550354-31550376 GCCGCGTGCGCCCTCGCCGCCGG + Intergenic
1147179229 17:38674250-38674272 CCCCCCTGCGCCCTGGCGGCTGG - Exonic
1148262033 17:46192889-46192911 GCCCTCGGCGCCCAGGCCGGGGG - Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148787815 17:50154029-50154051 GCCCTCAGCGCCCTGGGCGCAGG + Intergenic
1149610492 17:57955242-57955264 GTCCGCTCCGCGCGGGCCGCAGG + Exonic
1150675695 17:67244883-67244905 GCCCGCAGCGTCCTGGGCCCTGG - Intronic
1150798421 17:68259179-68259201 CCCGGCTGCGCCCAGGCCGGCGG + Exonic
1151657460 17:75502562-75502584 GGGCACTGCGTCCTGGCCGCCGG + Exonic
1151785628 17:76273619-76273641 GCCTGCTGCGCTCTTGCTGCTGG - Intergenic
1151994095 17:77597757-77597779 GCCAGCTGCGTCCTGGTCCCAGG + Intergenic
1152421528 17:80195848-80195870 GCCGGCTGCGCTCTGTCTGCTGG + Intronic
1152467964 17:80476385-80476407 GCCCTCTGCCTCCTGGGCGCCGG - Exonic
1152720732 17:81922687-81922709 GCCCGGGGCCCCCTTGCCGCCGG - Exonic
1152723288 17:81933223-81933245 GCCCGCTGGGGCCAGGCTGCGGG + Exonic
1152896668 17:82915236-82915258 ATCAGGTGCGCCCTGGCCGCAGG + Intronic
1153219137 18:2847093-2847115 GCGGGCGGCGCCCTGGCCGCCGG + Exonic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1155540406 18:26863476-26863498 GCCCGGTGCATCCTGGCCGCTGG + Intronic
1160391729 18:78539226-78539248 GCCCACTGCGCCCTGACCCTGGG + Intergenic
1160805664 19:991372-991394 TTCCCCTGCGCGCTGGCCGCGGG - Intronic
1161006876 19:1941451-1941473 GCCCCCTGCACCCTGGCCCTGGG + Intronic
1161026174 19:2038425-2038447 GCCTGCTGCCCCCTCCCCGCGGG - Exonic
1161864670 19:6825251-6825273 GCCCCCTGAGCCCTGGGCTCTGG + Intronic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162914356 19:13866005-13866027 CCCCGCTCAGGCCTGGCCGCGGG + Intronic
1162966937 19:14160527-14160549 CCCCGCTGGGCCCTGGGCCCTGG + Intronic
1163371160 19:16902059-16902081 GCCCGCTGCGGCCGGGTCCCAGG + Intronic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
1165058755 19:33194822-33194844 GCCAGCTGCGCCCGGGCGCCCGG - Exonic
1165102400 19:33446718-33446740 GCCCGCTGGGCCCTCCCCTCTGG - Intronic
1165690033 19:37855946-37855968 GGGCGCTACGCCCTGGACGCTGG - Intergenic
1165772588 19:38387787-38387809 GACCGCGGCGCCCTGGGCCCGGG + Exonic
1165923852 19:39315016-39315038 GCCAGCTGCCACCTGGCCGATGG + Exonic
1166048810 19:40245881-40245903 CCCTGCTGCGCCCTGGCCCTGGG - Intronic
1166702727 19:44891493-44891515 GCCACCTCCGCCCTCGCCGCCGG + Exonic
1167308429 19:48721906-48721928 ATCAGCTGGGCCCTGGCCGCGGG - Exonic
1167492776 19:49801806-49801828 GCCGGCAGCGCCCTGGACGATGG + Exonic
1167638023 19:50666637-50666659 CCCCGCTGGGGCCAGGCCGCAGG + Exonic
1167641879 19:50686849-50686871 GCCCGCTCCGCCCCGCCCCCGGG - Intronic
1168314628 19:55479217-55479239 GCCCGCCTCCCCCTGGCCTCCGG - Intronic
1168337721 19:55605754-55605776 CCCCGCTGCACCCGGGCCCCCGG - Intronic
926101845 2:10122903-10122925 GCCCGCAGCGCCCTCCCCGCGGG - Intronic
927679943 2:25132597-25132619 CCCCGCTCCGCCCTGGTCCCAGG + Intronic
927714011 2:25341356-25341378 CCCTCCGGCGCCCTGGCCGCGGG + Intronic
927972924 2:27316927-27316949 GCTCCCTTCCCCCTGGCCGCTGG - Intronic
929778581 2:44943374-44943396 GCCCGCTGCGCAGTGGCCTCTGG - Intronic
934966869 2:98731145-98731167 GCCGGCTCCGCCCCCGCCGCTGG + Intergenic
936559312 2:113523038-113523060 GCCCGCTGGGGCGTGGCGGCAGG - Intergenic
938487351 2:131724180-131724202 GCCACCTCCGCCCTCGCCGCCGG - Intronic
941686789 2:168456099-168456121 AGTCGCTGCGCCCTGGGCGCAGG - Intronic
943725245 2:191245739-191245761 GCCCGCTGACCCCCGCCCGCAGG - Intronic
944496071 2:200307523-200307545 ACGCGGAGCGCCCTGGCCGCGGG + Intronic
946321989 2:218959784-218959806 TCCCGCTGGGGCCTGGGCGCCGG + Exonic
947860617 2:233354839-233354861 GCGCGCTCCGCCCGGGGCGCCGG - Intronic
947947736 2:234120873-234120895 GCCCCCTGTGTCCTGGCCACAGG - Intergenic
948824335 2:240567008-240567030 GCCCCCAGCGCCCTGCCCGGTGG - Intronic
1168757335 20:326340-326362 GGCCGCAGCTGCCTGGCCGCGGG + Exonic
1168796004 20:610433-610455 GTCCGCCGCGCCCTGGCCAATGG + Intergenic
1168830131 20:841295-841317 CCCGGCTGCGCCCGCGCCGCTGG - Intronic
1170667539 20:18399782-18399804 GCCAGCTGCTCCTTGGCCTCAGG - Intronic
1170852576 20:20017879-20017901 CCCCTCTGCGGCCTGGCCGTCGG - Intronic
1171175469 20:23048695-23048717 GCCGGCTGGGCACTGGCAGCGGG + Exonic
1174386512 20:50190978-50191000 GCCCGCTCCGGCCGGCCCGCAGG - Exonic
1175729845 20:61346790-61346812 TCCTGCTGCACCCTGGCCCCCGG - Intronic
1176115052 20:63428580-63428602 GCCCACTGGGCCCTGGGCTCAGG + Intronic
1178610313 21:34073811-34073833 CCCCCGCGCGCCCTGGCCGCGGG + Intronic
1179802028 21:43815540-43815562 CCCCACTGCACCCTGGCCTCGGG - Intergenic
1180018213 21:45101269-45101291 GCTCGCTGTGCCCTGCGCGCGGG + Intronic
1180086477 21:45510001-45510023 GCCCCCTGCACCCAGGCCCCGGG - Intronic
1180491868 22:15855180-15855202 GCCACCTCCGCCCTCGCCGCCGG - Intergenic
1180837275 22:18936189-18936211 GCCCGCTGCGGGCTGCTCGCGGG + Exonic
1180913965 22:19472420-19472442 GCCCGCTGGGCCCAGGCCCTAGG - Intronic
1181083759 22:20429902-20429924 GGACCCTGGGCCCTGGCCGCGGG - Intronic
1182445460 22:30387150-30387172 CCCCGCCCCGCCCCGGCCGCCGG + Exonic
1183352305 22:37341125-37341147 GACCCCTGCCCCCTGGCTGCTGG - Intergenic
1183393770 22:37560463-37560485 GTCTGCGCCGCCCTGGCCGCGGG - Exonic
1183437858 22:37805569-37805591 GCCCGCTTGGGCTTGGCCGCAGG - Exonic
1183673038 22:39283927-39283949 GCCCGCGGCCCCCTGCCCGGCGG + Intergenic
1184663745 22:45977034-45977056 GCCAGCCGCGCCCGGGCCCCCGG - Exonic
1184790751 22:46698300-46698322 GCCCACTGCGGCCGAGCCGCAGG + Intronic
1184837839 22:47034556-47034578 GCCCACTGCACCCTGGCATCAGG + Intronic
1184893377 22:47392961-47392983 GCCCTCTGTGGCCTGGCCCCAGG + Intergenic
1185094606 22:48799550-48799572 GCCTGCTGGGCCCTGGGAGCAGG - Intronic
1185117203 22:48944672-48944694 GCCAGCTGGGCCCTGGCTGGAGG + Intergenic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1203287368 22_KI270734v1_random:161488-161510 GCCCGCTGCGGGCTGCTCGCGGG + Intergenic
950442877 3:13020019-13020041 GCCCGCTGTGCCCTGTCCAAGGG - Intronic
950528862 3:13540785-13540807 GCCTGCTGGGCCGTGGCCCCAGG + Intergenic
951558896 3:23946170-23946192 GCCCGCTGAGCCCCCGCGGCGGG + Intronic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
952764828 3:36944863-36944885 GCCCGCCGCGCCCTGCCCACAGG - Exonic
954131037 3:48561055-48561077 GCCTGCTGCTCCCCGGCCCCAGG + Intronic
954277917 3:49554551-49554573 TCGCGCTGCGCCCGGGCCGGCGG - Exonic
954293431 3:49661613-49661635 GCCCACTGCTGCCTGGCCCCAGG - Exonic
954662083 3:52231661-52231683 ACCTGCTGCGTCCTGGCCCCGGG - Intronic
954912265 3:54120829-54120851 GCCAGGTGCGCCCCGCCCGCGGG - Intergenic
956678059 3:71753805-71753827 GCCCGCGGCGCCTAGGGCGCAGG + Intronic
960632167 3:119743197-119743219 GCCCTCTGCCTCCTGGGCGCAGG + Intronic
961359332 3:126357258-126357280 GACCGCCGGGGCCTGGCCGCCGG - Exonic
961780144 3:129316273-129316295 GCGCGCTGCGCTCTGGCGGGAGG + Exonic
963253319 3:143120918-143120940 GCCAGCGGCGTCCTGGGCGCCGG - Exonic
965615137 3:170585645-170585667 GCCCGGTGCCCCCAGACCGCGGG + Intronic
967762452 3:193241188-193241210 GCCCGCTCCGCCCAGGAGGCGGG - Exonic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968746928 4:2365086-2365108 GCCCGCTGCCCACTGCCTGCGGG - Intronic
968934159 4:3601259-3601281 GGCCCCTGCTCCCTGACCGCTGG - Intergenic
969371234 4:6732844-6732866 GCCCGCAGTGGCCAGGCCGCAGG + Intergenic
972670999 4:41214148-41214170 GCGCCCTGCGCCCGCGCCGCAGG - Intronic
973293243 4:48490380-48490402 GCCCGCCGCGCCCTTGCCCTTGG - Exonic
976824920 4:89249789-89249811 GCTGGCTGCTCCCTGGCAGCTGG + Exonic
980130399 4:128811709-128811731 GGCCGCTGCGCCCCCGCCCCGGG + Intronic
981745011 4:148044460-148044482 GCCAGCAGCTCCCTGGCTGCAGG - Intronic
985490096 5:174194-174216 GCCCCCAGCCCCCTGGCCCCTGG - Intronic
985704173 5:1391096-1391118 GCCCCATGCCCGCTGGCCGCTGG - Intergenic
986402721 5:7395871-7395893 TCCCGCTGCGCCCCGGCCCGGGG - Intergenic
994043772 5:95285245-95285267 GCTCGCTGTGCGCTGGCCGCTGG + Intergenic
995462821 5:112420257-112420279 GCACACTGCGCCCAAGCCGCGGG + Intergenic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1002059789 5:176619586-176619608 GCCAGCAGAGCCCTGGCCTCCGG - Intergenic
1002300124 5:178253164-178253186 GCCAGCTGGGCCCTGGTGGCAGG - Intronic
1003049335 6:2765770-2765792 GCGCGGTGCGACCCGGCCGCGGG - Exonic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003175849 6:3751813-3751835 GCCCGCGGCGCCCGTTCCGCGGG - Exonic
1003567270 6:7231521-7231543 GCCCGCTGGGCCCTGCTCGGTGG - Exonic
1004193988 6:13487738-13487760 GCGCGCTGCGCCCGGGCCCCGGG + Intergenic
1006396158 6:33788864-33788886 GCCCGCCGCGGCCTCTCCGCGGG - Exonic
1006634557 6:35452591-35452613 TCCAGCTGCGCCCAGGGCGCCGG - Exonic
1007327649 6:41073798-41073820 GCCCGCTCCGCCCGGGTCTCCGG + Intronic
1013220711 6:108074818-108074840 GCCGGCTGCCTCCGGGCCGCAGG + Intronic
1014035801 6:116765535-116765557 GCCTACTGCGCCTTGGCCGCGGG - Exonic
1018238412 6:161748976-161748998 CCCAGCTGCCCCCTGGCGGCGGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1022363264 7:29684659-29684681 GCCCCCGGCGCCCCGGCCGAAGG + Intergenic
1022400210 7:30028908-30028930 TCCCGCTCCGCGCTGGCCTCAGG - Intronic
1023722696 7:43112783-43112805 TCTCGCTGCGCTCTGGCTGCCGG - Exonic
1024062443 7:45709236-45709258 GCCAGCTGGGCCCTGGGCTCTGG + Intronic
1024533187 7:50409895-50409917 GCCCCCTCCTCCCTGGCCGCAGG + Intergenic
1026009964 7:66628949-66628971 GCCGGCTGCGGGCTGGCCGGAGG - Exonic
1026995413 7:74612724-74612746 GCCTGCTGGGCCTGGGCCGCTGG - Intergenic
1027151860 7:75738978-75739000 GCCCGCCCCGCCCTACCCGCGGG + Intergenic
1027152061 7:75739582-75739604 CCACGCTGCGCCCCGCCCGCGGG - Intergenic
1028709399 7:93890535-93890557 GCCCGCTGCGCCCTCTCCGCCGG + Intronic
1029126261 7:98297010-98297032 GCCCGCGGGGCCCTGGGTGCCGG - Intronic
1029485673 7:100838588-100838610 GCTCACTGCGACCTGGCCTCTGG + Intronic
1033682973 7:143614381-143614403 GCCTGCTGGGCCCTGGCCTACGG - Intergenic
1033701640 7:143843257-143843279 GCCTGCTGGGCCCTGGCCTACGG + Intergenic
1034264126 7:149773118-149773140 GGCCGCTCCGCCCGCGCCGCGGG + Exonic
1034285350 7:149880206-149880228 GCCCTCTGCCCCCTGGCCCTGGG + Exonic
1035522523 8:286717-286739 CCTCGCCGCTCCCTGGCCGCAGG + Intergenic
1035635206 8:1139128-1139150 GGCCGCTGCGGCCTGGCTGGGGG + Intergenic
1039996893 8:42541776-42541798 GCCCGCCCCGCCCCGGACGCGGG + Intronic
1042367335 8:67952316-67952338 GCCCGCTGCTGCCCGGCCCCCGG - Exonic
1048833372 8:138497057-138497079 ACCGGCTGCGCCCGCGCCGCTGG + Intergenic
1049457292 8:142700259-142700281 GCCCGTTCCTGCCTGGCCGCCGG + Exonic
1049592047 8:143466995-143467017 TCCCTCTCAGCCCTGGCCGCTGG - Intronic
1049608600 8:143541481-143541503 GCCCGCTCCGCCCCGCCCGCGGG - Intergenic
1049778386 8:144416531-144416553 GCCAGCTCCGCCCTGCCAGCCGG - Intronic
1049893543 9:93159-93181 GCCCGCTGGGGCGTGGCGGCAGG + Intergenic
1053131315 9:35617312-35617334 ACCCGCTTCGCCCTCGCCACTGG + Intronic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057026773 9:91740103-91740125 GCAGGCTTCTCCCTGGCCGCTGG + Intronic
1057292961 9:93818891-93818913 GCCCTCTGAGCCCTGGCTGGAGG + Intergenic
1059061417 9:111038310-111038332 GCCCCCTGCGCCCACCCCGCCGG + Intronic
1060812012 9:126615310-126615332 GCCCGGTGCGACCGGGACGCCGG + Intronic
1061074441 9:128332614-128332636 GTCCTCTGCGCCCTGACCCCAGG + Intronic
1061208465 9:129177452-129177474 GCCCGCTGCGCTCTGCCCGCGGG - Exonic
1061208611 9:129178126-129178148 GCCCGGCGCGCCCCGGCGGCCGG - Exonic
1061587436 9:131578149-131578171 TCCCGCAGCGCCCTGCCTGCAGG + Exonic
1062162375 9:135087535-135087557 CCCCGCCGCCCCCTGGCTGCTGG - Intronic
1062206755 9:135341805-135341827 GCCCTCTGAGCCTTGGCCGGTGG - Intergenic
1062452432 9:136621237-136621259 GCCCGGTGCGCCCTCCCCGTGGG - Intergenic
1062467378 9:136687193-136687215 GCCTGCTGCGCCACGGCGGCCGG - Exonic
1062542045 9:137045847-137045869 GCGCGCTGGGCGCAGGCCGCGGG - Intronic
1062584178 9:137241581-137241603 GCCCCGCGCGCCCTGGCCGCCGG - Intronic
1062596756 9:137302987-137303009 TCCCGCTGCGCCCCGGCCCGGGG - Intergenic
1187443796 X:19343690-19343712 TCCCGCGGCGCCCTGGAGGCGGG + Intergenic
1189474055 X:41335102-41335124 GGCCGCTGCGCGCTGGGCCCTGG + Intronic
1191216216 X:57934467-57934489 GCCCACTGCTCCCTGGACTCTGG - Intergenic
1192638485 X:72843006-72843028 GCCCCCTGAGCCCTGGCCTTTGG + Intronic
1192643229 X:72877802-72877824 GCCCCCTGAGCCCTGGCCTTTGG - Intronic
1197962763 X:132023706-132023728 GCCCGGTGCGCCCTCGGTGCTGG + Intergenic
1199248342 X:145631906-145631928 GCTCGCTGGGCCCTGTCCTCAGG - Intergenic
1199942365 X:152638472-152638494 GCTCGCTGAGCCCTGGCGCCCGG + Intronic
1202202381 Y:22367177-22367199 GCTCCCTGCGCCATGGCAGCTGG - Intronic