ID: 1155514271

View in Genome Browser
Species Human (GRCh38)
Location 18:26608417-26608439
Sequence TGTTATGTGCCAGTTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 506}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155514269_1155514271 -9 Left 1155514269 18:26608403-26608425 CCTAGAGCTTCATTTGTTATGTG 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1155514271 18:26608417-26608439 TGTTATGTGCCAGTTGGACATGG 0: 1
1: 0
2: 0
3: 20
4: 506
1155514268_1155514271 -1 Left 1155514268 18:26608395-26608417 CCGATTCACCTAGAGCTTCATTT 0: 1
1: 0
2: 3
3: 18
4: 169
Right 1155514271 18:26608417-26608439 TGTTATGTGCCAGTTGGACATGG 0: 1
1: 0
2: 0
3: 20
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155514271 Original CRISPR TGTTATGTGCCAGTTGGACA TGG Intronic
900890044 1:5443044-5443066 TGTTATGTGTCAACTGGACTGGG + Intergenic
901115178 1:6837987-6838009 TCTTAAGTTCCAGGTGGACAGGG + Intronic
902572257 1:17354403-17354425 TGCTATGTGCCAGCTGTAGACGG + Intronic
904814179 1:33182690-33182712 TCTTGTGTGCCAGATGGAGAGGG + Intergenic
905246572 1:36618672-36618694 TGTTTAGGGACAGTTGGACATGG + Intergenic
905255578 1:36680376-36680398 TGTTATATGCCAGTTGGGGAAGG + Intergenic
905570099 1:38996817-38996839 TGTTATGGGCCAGCTGGGTATGG - Intronic
906563795 1:46781649-46781671 TGATATTTTCCTGTTGGACAAGG + Intronic
906573546 1:46866381-46866403 TGCTACCTGCCAGTTGGTCACGG - Intergenic
906598320 1:47100523-47100545 TGCTACCTGCCAGTTGGTCACGG + Intronic
906876967 1:49549993-49550015 TGATATTTTCCTGTTGGACAAGG + Intronic
906910717 1:49945987-49946009 TGATATTTTCCTGTTGGACAAGG - Intronic
907372195 1:54010772-54010794 TGTGATGTTCCAGTTGGAAGAGG - Intronic
907868814 1:58424405-58424427 TTTTATGTGTCAGTTTGACTGGG - Intronic
908174892 1:61545703-61545725 TGATATTTTCCTGTTGGACAAGG + Intergenic
908298775 1:62740196-62740218 TGATATTTTCCTGTTGGACAAGG - Intergenic
909673848 1:78216990-78217012 TGATATTTTCCTGTTGGACAAGG - Intergenic
909725001 1:78824175-78824197 TTTTATGTGTCAGTTTGACTGGG + Intergenic
909830504 1:80183360-80183382 TGATATTTTCCTGTTGGACAAGG + Intergenic
909948143 1:81687352-81687374 TGATATTTTCCTGTTGGACAAGG + Intronic
909981177 1:82103271-82103293 TGATATTTTCCTGTTGGACAAGG + Intergenic
910738775 1:90492698-90492720 TGATATTTTCCTGTTGGACAAGG + Intergenic
911318066 1:96378577-96378599 TGATATTTTCCTGTTGGACAAGG - Intergenic
911678697 1:100689757-100689779 TGATATTTTCCTGTTGGACAAGG + Intergenic
911689351 1:100814446-100814468 TGATATTTTCCTGTTGGACAAGG - Intergenic
912100361 1:106196148-106196170 TGATATTTTCCTGTTGGACAAGG + Intergenic
913151569 1:116049028-116049050 TGATATTTTCCTGTTGGACAAGG - Intronic
913337954 1:117726893-117726915 TGATATTTTCCTGTTGGACAAGG - Intergenic
913339532 1:117745046-117745068 TGATATTTTCCTGTTGGACAAGG + Intergenic
913587958 1:120294817-120294839 TGATATTTTCCTGTTGGACAAGG + Intergenic
913620227 1:120603552-120603574 TGATATTTTCCTGTTGGACAAGG - Intergenic
914569974 1:148906681-148906703 TGATATTTTCCTGTTGGACAAGG + Intronic
914602855 1:149223587-149223609 TGATATTTTCCTGTTGGACAAGG - Intergenic
916202840 1:162288074-162288096 TGTTTTGTGCCAGTTGTATGTGG + Intronic
917057691 1:171001951-171001973 TGATATTTTCCTGTTGGACAAGG + Intronic
917446898 1:175114236-175114258 TTTAATGTGCCAGTTGGGAAGGG + Intronic
917907781 1:179605084-179605106 TGATATTTTCCTGTTGGACAAGG + Intronic
917957831 1:180118451-180118473 TGTGATTTTCCAGTTGGAAATGG + Intergenic
918158565 1:181874706-181874728 TGATATTTTCCTGTTGGACAAGG - Intergenic
918721629 1:187859505-187859527 TGATATTTTCCTGTTGGACAAGG + Intergenic
918750590 1:188264721-188264743 TGATATTTTCCTGTTGGACAAGG + Intergenic
919170650 1:193949480-193949502 TTTTATGTGTCAGTTTGACTAGG - Intergenic
919278083 1:195446696-195446718 TGATATTTTCCTGTTGGACAAGG - Intergenic
919397791 1:197072043-197072065 TGATATTTTCCTGTTGGACAAGG - Intergenic
919407824 1:197206947-197206969 TGATATTTTCCTGTTGGACAAGG + Intergenic
920726755 1:208443440-208443462 TGATATTTTCCTGTTGGACAAGG + Intergenic
922188868 1:223299566-223299588 TTTTATATGCCAGTTTGACTGGG + Intronic
922395802 1:225200044-225200066 TGATATTTTCCTGTTGGACAAGG + Intronic
922658086 1:227403152-227403174 TGATATTTTCCTGTTGGACAAGG - Intergenic
922927151 1:229359125-229359147 TGATATTTTCCTGTTGGACAAGG + Intergenic
923648452 1:235847820-235847842 TGATATCTTCCTGTTGGACAAGG - Intronic
923885239 1:238146971-238146993 TTTTATGTGTCAGTTGGACTGGG - Intergenic
923960920 1:239082892-239082914 TGATATTTTCCTGTTGGACAAGG + Intergenic
923996489 1:239501056-239501078 TGATATTTGCCTGTTGCACAAGG - Intronic
924321200 1:242852859-242852881 TGATATTTTCCTGTTGGACAGGG + Intergenic
1063250905 10:4273654-4273676 TTTTATGTGTCAGTTTGACTGGG + Intergenic
1063708287 10:8452305-8452327 TGTTATGTGGCAATTTGCCATGG - Intergenic
1064907929 10:20368215-20368237 TGATATTTTCCTGTTGGACAAGG + Intergenic
1065318044 10:24483711-24483733 TGTTATGGGCCAGCTGAACACGG - Intronic
1066145320 10:32552110-32552132 TGATATTTTCCTGTTGGACAAGG + Intronic
1070433849 10:76368813-76368835 TGATATTTTCCTGTTGGACAAGG + Intronic
1071405612 10:85328050-85328072 TGATATTTTCCTGTTGGACAAGG + Intergenic
1071744842 10:88405408-88405430 TGATATTTTCCTGTTGGACAAGG + Intronic
1072928235 10:99635900-99635922 TGATATTTTCCTGTTGGACAAGG - Intergenic
1074785204 10:116833166-116833188 TGTTATGGGCCTGTTAGCCAAGG - Intergenic
1074985610 10:118656769-118656791 TGATATTTTCCTGTTGGACAAGG + Intergenic
1075982537 10:126753573-126753595 TGATATTTTCCTGTTGGACAAGG + Intergenic
1076665385 10:132086570-132086592 TGATATTTTCCTGTTGGACAAGG + Intergenic
1076833228 10:133007345-133007367 TTTTATGTCCCAGTTGGCCCAGG + Intergenic
1078646408 11:13144678-13144700 TTTTATGTGCCAGCTTGACTAGG - Intergenic
1078706789 11:13751432-13751454 TGATATTTTCCTGTTGGACAAGG - Intergenic
1079207845 11:18432673-18432695 TGATATTTTCCTGTTGGACAAGG + Intronic
1079273451 11:19011270-19011292 TGATATTTTCCTGTTGGACAAGG + Intergenic
1080402508 11:31949301-31949323 TGATATTTTCCTGTTGGACAAGG - Intronic
1080672334 11:34392764-34392786 TGATATTTTCCTGTTGGACAAGG + Intergenic
1081050523 11:38334543-38334565 TGATATTTTCCTGTTGGACAAGG - Intergenic
1081331631 11:41808161-41808183 TGGTATATGTCAGTTTGACAGGG - Intergenic
1082140302 11:48601390-48601412 TGATATTTTCCTGTTGGACAAGG + Intergenic
1083064369 11:59909048-59909070 TGGTATTTTCCTGTTGGACAAGG + Intergenic
1085748078 11:79131965-79131987 TGATATTTTCCTGTTGGACAAGG - Intronic
1085917369 11:80905457-80905479 TGATATTTTCCTGTTGGACAAGG - Intergenic
1086264795 11:84984915-84984937 TGATATTTTCCTGTTGGACAAGG - Intronic
1087016647 11:93560587-93560609 TTTTATGTGCCAATTTGACTGGG + Intergenic
1088206643 11:107399502-107399524 TGATATTTTCCTGTTGGACAAGG - Intronic
1089107596 11:116026073-116026095 TGATATTTTCCTGTTGGACAAGG - Intergenic
1089826041 11:121278790-121278812 TGATATTTTCCTGTTGGACAAGG + Intergenic
1090756913 11:129800201-129800223 TGGTATTTTCCTGTTGGACAAGG - Intergenic
1090894804 11:130962417-130962439 TGATATTTTCCTGTTGGACAAGG + Intergenic
1091210260 11:133852162-133852184 TGATATTTTCCTGTTGGACATGG + Intergenic
1091237109 11:134029610-134029632 TGTTAAGTTCCTCTTGGACAAGG - Intergenic
1092272686 12:7036194-7036216 TTTTATGTGCCAATTTGACTGGG + Intronic
1093010740 12:14103940-14103962 TGATATTTTCCTGTTGGACAAGG - Intergenic
1093118152 12:15236045-15236067 AGTTATGTGACAGCTGGAGACGG - Intronic
1093646842 12:21595723-21595745 TGATATTTTCCTGTTGGACAAGG - Intronic
1093720782 12:22439389-22439411 TGATATTTTCCTGTTGGACAAGG - Intergenic
1093991636 12:25595010-25595032 TGATATTTTCCTGTTGGACAAGG - Intronic
1093995172 12:25633105-25633127 TGATATTTTCCTGTTGGACAAGG - Intronic
1094447153 12:30544213-30544235 TGATATTTTCCTGTTGGACAAGG + Intergenic
1095341031 12:41088429-41088451 GTTTATGTGCCAGTTTGACAGGG - Intergenic
1095893023 12:47252369-47252391 TGATATTTTCCTGTTGGACAAGG - Intergenic
1095932275 12:47639096-47639118 TGATATTTTCCTGTTGGACAAGG - Intergenic
1096032074 12:48427603-48427625 TGATATTTTCCTGTTGGACAAGG - Intergenic
1096348097 12:50868426-50868448 TGTTATTTTCCTGTTGGACAAGG - Intronic
1096957049 12:55536786-55536808 TGATATTTTCCTGTTGGACAAGG - Intergenic
1097353296 12:58572641-58572663 TTTTATGTGTCAGTTTGACTTGG + Intronic
1097385749 12:58948448-58948470 TGATATTTTCCTGTTGGACAAGG + Intergenic
1097547701 12:61024619-61024641 TGATATTTTCCTGTTGGACAAGG + Intergenic
1099393601 12:82110624-82110646 TTTTATGTGCCAACTGGACTGGG - Intergenic
1099777216 12:87149352-87149374 TGATATATTCCTGTTGGACAAGG + Intergenic
1099905610 12:88766162-88766184 TGTTAAGCCCCAGTTTGACAGGG + Intergenic
1100203382 12:92323433-92323455 TGATATTTTCCTGTTGGACAAGG + Intergenic
1100706505 12:97205778-97205800 TGATATTTTCCTGTTGGACAGGG - Intergenic
1101635059 12:106533489-106533511 TGATATTTTCCTGTTGGACAAGG + Intronic
1102834980 12:116047783-116047805 GGTTATGTGGCAGTAGAACATGG - Intronic
1102916512 12:116758035-116758057 TGATATTTTCCTGTTGGACAAGG + Intronic
1104524461 12:129505733-129505755 TGATATTTTCCTGTTGGACAAGG + Intronic
1105249625 13:18686150-18686172 TGTGATGGGCCAGGTAGACAGGG + Intergenic
1105825078 13:24115271-24115293 TGTTATGCAGCAGTTGGTCATGG - Intronic
1105930967 13:25051481-25051503 TGATATTTTCCTGTTGGACAAGG - Intergenic
1107961128 13:45560086-45560108 TGATATTTTCCTGTTGGACAAGG + Intronic
1108213521 13:48161404-48161426 TGTTCTTTGCCAGTTTGAGAAGG - Intergenic
1108469572 13:50754383-50754405 TGATATTTTCCTGTTGGACAAGG + Intronic
1108549197 13:51526283-51526305 TGTTATGTGTCAGCTTGACCGGG - Intergenic
1108824724 13:54398843-54398865 TTTTATGTGTCAGTTTGACTGGG + Intergenic
1108825771 13:54410246-54410268 TGATATTTTCCCGTTGGACAAGG - Intergenic
1109086282 13:57974626-57974648 TGTTCTGTGTCTGTTGGACATGG - Intergenic
1110204617 13:72897743-72897765 TGATATTTTCCTGTTGGACAAGG - Intronic
1110645418 13:77877728-77877750 TCTTGTGTGACAGCTGGACAAGG + Intergenic
1110701654 13:78555541-78555563 TGTTATGTGCCAGTGGGGGTGGG - Intergenic
1110834913 13:80072729-80072751 GATTAGGTGCAAGTTGGACATGG - Intergenic
1112607963 13:100926676-100926698 TTTTATGTGTCAATTTGACAGGG + Intergenic
1113845421 13:113386520-113386542 TGATATTTTCCTGTTGGACAAGG + Intergenic
1114691971 14:24591987-24592009 TGATATTTTCCTGTTGGACAAGG + Intergenic
1115265234 14:31493607-31493629 TGATATTTTCCTGTTGGACAAGG - Intronic
1115524803 14:34269134-34269156 TTTTATGAGACAGTTGGAGAAGG - Intronic
1115526978 14:34291120-34291142 TGATATTTTCCTGTTGGACAAGG + Intronic
1115680527 14:35732680-35732702 TGATATTTTCCTGTTGGACAAGG - Intronic
1115958897 14:38812179-38812201 TGATATTTTCCTGTTGGACAAGG - Intergenic
1115970055 14:38934854-38934876 TGATATTTTCCTGTTGGACAAGG - Intergenic
1115997255 14:39206983-39207005 TGATATTTTCCTGTTGGACAAGG - Intergenic
1116088791 14:40277403-40277425 TGATATTTTCCTGTTGGACAGGG + Intergenic
1116223574 14:42118625-42118647 TGATATTTTCCTGTTGGACAAGG + Intergenic
1116304629 14:43235655-43235677 TGTTATTTGACATTTGGATATGG - Intergenic
1117112976 14:52477605-52477627 TGATATTTTCCTGTTGGACAAGG - Intronic
1117811849 14:59555538-59555560 TGTGATGTGCCAGTTTTCCAAGG - Intronic
1118162511 14:63304119-63304141 TGATATTTTCCTGTTGGACAAGG - Intergenic
1119098681 14:71858380-71858402 TGATATTTTCCTGTTGGACAAGG - Intergenic
1119126818 14:72135045-72135067 TTTTATGTGTCAGTTGAACTGGG - Intronic
1120501203 14:85299335-85299357 TGAAATGTGTAAGTTGGACAAGG + Intergenic
1121460078 14:94068291-94068313 TGATATTTTCCTGTTGGACAAGG - Intronic
1121663902 14:95657519-95657541 TTTTATGTGTCAATTTGACAGGG + Intergenic
1121993312 14:98582347-98582369 TGTTTTGTACCAGTTCTACAGGG + Intergenic
1124380938 15:29164607-29164629 TGATATTTTCCTGTTGGACAAGG - Intronic
1124386736 15:29215150-29215172 TGATATTTTCCGGTTGGACAAGG + Intronic
1124557342 15:30738410-30738432 TGATATTTTCCTGTTGGACAAGG - Intronic
1124711686 15:32017899-32017921 TGTAATGTGCCTATTTGACAAGG - Intergenic
1125273244 15:37963763-37963785 TGATATTTTCCTGTTGGACAAGG + Intronic
1127007993 15:54592507-54592529 TGATATTTTCCTGTTGGACAAGG + Intronic
1128238956 15:66087102-66087124 TGATATTTTCCTGTTGGACAAGG - Intronic
1128415229 15:67438835-67438857 TGATATTTTCCTGTTGGACAAGG - Intronic
1129466160 15:75725431-75725453 TCTGCTGTGCCAGCTGGACAGGG - Intronic
1129928871 15:79391793-79391815 TGATATTTTCCTGTTGGACAAGG + Intronic
1129941509 15:79501148-79501170 TTTTATGTGTCAGCTTGACAGGG + Intergenic
1131326639 15:91454227-91454249 TGATATTTTCCTGTTGGACAAGG + Intergenic
1137444290 16:48522405-48522427 TGCCATGTGCCTGTTGAACAAGG - Intergenic
1138881226 16:61016811-61016833 TGATATTTTCCTGTTGGACAAGG - Intergenic
1139524385 16:67505052-67505074 TGTTATTTGTCAGCTGGGCACGG + Intergenic
1140539611 16:75744709-75744731 TGTTCTAGGCCAGTTGGAAATGG - Intronic
1142840949 17:2629794-2629816 TGGTATTTTCCTGTTGGACAAGG + Intronic
1143991036 17:10961868-10961890 TGATATTTTCCTGTTGGACAAGG - Intergenic
1146289148 17:31595817-31595839 TAATACGTGCCAGTTGCACAGGG + Intergenic
1146751234 17:35382948-35382970 TGATATTTTCCTGTTGGACAAGG + Intergenic
1147462975 17:40587109-40587131 TGATATTTTCCTGTTGGACAAGG + Intergenic
1148626045 17:49069690-49069712 TGTAATGTTCCAGTAGAACAGGG + Intergenic
1149221600 17:54420612-54420634 TGATATTTTCCTGTTGGACAAGG - Intergenic
1149410690 17:56403409-56403431 TGATATTTTCCTGTTGGACAAGG + Intronic
1150115316 17:62543215-62543237 TTTTTGGTGCCAGTTGGTCACGG + Intronic
1151048599 17:70949892-70949914 TGATATTTTCCTGTTGGACAAGG - Intergenic
1151685431 17:75643465-75643487 TGGTGTGTGCCAGTTGGCCAAGG - Intronic
1153069281 18:1087257-1087279 TGATATTTTCCTGTTGGACAAGG + Intergenic
1153071728 18:1113906-1113928 TGATATTTTCCTGTTGGACAAGG + Intergenic
1153079705 18:1208441-1208463 TGATATTTTCCTGTTGGACAAGG + Intergenic
1153168710 18:2291403-2291425 TGATATTTTCCTGTTGGACAAGG + Intergenic
1153396191 18:4623899-4623921 TGATATTTTCCTGTTGGACAAGG + Intergenic
1153729896 18:8000213-8000235 TTTTATGTGTCAGGTTGACAAGG - Intronic
1153796235 18:8625176-8625198 TGTTATATGCCACTTGCACATGG + Intronic
1155514271 18:26608417-26608439 TGTTATGTGCCAGTTGGACATGG + Intronic
1156860291 18:41828203-41828225 TGGTATTTGCCAGTTGGAGATGG + Intergenic
1157218798 18:45809154-45809176 TGATATTTTCCTGTTGGACAAGG - Intergenic
1158579462 18:58669004-58669026 TATTATTTCACAGTTGGACAGGG - Intergenic
1158699611 18:59734410-59734432 TGTTAATTGCCAGCTGGACAGGG - Intergenic
1159134602 18:64322272-64322294 TTTTATGTGCCAGATTGACTGGG + Intergenic
1161306546 19:3572333-3572355 TGTGATGTCCCCGTTGCACAGGG + Intronic
1164814311 19:31182841-31182863 TTTTATGTGCTAATTTGACAAGG + Intergenic
1164908680 19:31987960-31987982 TTTTATGTGCCAATTTGACTGGG + Intergenic
1164927014 19:32138821-32138843 CCTTATGTCCCAGTTTGACAGGG + Intergenic
1165312210 19:35035210-35035232 TGTTGTTTGGCAGTTGGCCAGGG + Intronic
1166604039 19:44124726-44124748 TGATATTTTCCTGTTGGACAAGG + Intronic
1168104293 19:54157125-54157147 TGTTATGAACCAGTTGGACCAGG + Intronic
1168395870 19:56047934-56047956 TGATATTTTCCTGTTGGACAAGG + Intronic
925127253 2:1467899-1467921 TGATATTTTCCTGTTGGACAAGG + Intronic
925479789 2:4257384-4257406 TGTTATTTGCCAGTTAGACTTGG - Intergenic
926560392 2:14410455-14410477 TGATATTTTCCTGTTGGACAAGG - Intergenic
927328140 2:21830529-21830551 TGATATTTTCCTGTTGGACAAGG + Intergenic
928733921 2:34263430-34263452 TGATATTTTCCTGTTGGACAAGG - Intergenic
928856176 2:35805080-35805102 TGATATTTTCCTGTTGGACAAGG - Intergenic
929722694 2:44387226-44387248 TGATATTTTCCTGTTGGACAAGG + Intronic
930277925 2:49335340-49335362 TTTTATGTGTCACATGGACAAGG - Intergenic
930648257 2:53935806-53935828 TTTTATGTGCCACTTGGAATTGG + Intronic
930724197 2:54666799-54666821 TGTTTCATGCCAGTTGGACTAGG + Intronic
931136799 2:59412222-59412244 TGGTATTTTCCTGTTGGACAAGG + Intergenic
932270513 2:70405004-70405026 TGATATTTTCCTGTTGGACAAGG - Intergenic
936984770 2:118298445-118298467 TTTTATGTGTCAGCTTGACAGGG + Intergenic
937058079 2:118956422-118956444 TGATATCTTCCTGTTGGACAAGG - Intronic
937480511 2:122253585-122253607 TGATATTTTCCTGTTGGACAAGG - Intergenic
937521952 2:122722328-122722350 TGATATCTTCCTGTTGGACAAGG - Intergenic
937971865 2:127556108-127556130 TGATATTTTCCTGTTGGACAAGG + Intronic
940034493 2:149299757-149299779 TGATATTTTCCTGTTGGACAAGG + Intergenic
940135518 2:150431641-150431663 TGTTATCTGGAAGTTGGCCAGGG - Intergenic
940157020 2:150667941-150667963 TGATATTTTCCTGTTGGACAAGG - Intergenic
940636342 2:156301916-156301938 TGTTGTTTGCAAGTTGGAAAAGG + Intergenic
940709188 2:157142033-157142055 TGATATTTTCCTGTTGGACAAGG + Intergenic
940802423 2:158147398-158147420 TGATATTTTCCTGTTGGACAAGG - Intergenic
943130545 2:183848436-183848458 TGATATTTTCCTGTTGGACAAGG - Intergenic
943199196 2:184797338-184797360 TGTTATTTTCCTGTTGGAGAAGG + Intronic
944528675 2:200646768-200646790 TGATATTTTCCAGTTGTACAAGG + Intronic
944922363 2:204428843-204428865 TGATGTGTAGCAGTTGGACAGGG + Intergenic
945131859 2:206582254-206582276 TGATATTTTCCTGTTGGACAAGG + Intronic
945482335 2:210358545-210358567 TGATATTTTCCTGTTGGACAAGG + Intergenic
948136191 2:235638106-235638128 TGTTACGTGTCAGTTTGACTGGG - Intronic
1168840104 20:904530-904552 TGTTAAGTGACAGGTGTACAAGG - Intronic
1169401536 20:5284945-5284967 TGATATTTTCCTGTTGGACAAGG - Intergenic
1169517230 20:6331066-6331088 TGATATTTTCCTGTTGGACAAGG + Intergenic
1170133748 20:13051366-13051388 TGATATTTTCCTGTTGGACAAGG - Intronic
1170245542 20:14218224-14218246 TGATATTTTCCTGTTGGACAAGG + Intronic
1170603932 20:17861969-17861991 TGTTTTATGTCAGGTGGACAGGG - Intergenic
1170720815 20:18877301-18877323 TGATATTTTCCTGTTGGACAGGG + Intergenic
1171066753 20:22024691-22024713 TGATATTTTCCTGTTGGACAAGG + Intergenic
1171081388 20:22188977-22188999 TGATATTTTCCTGTTGGACAAGG + Intergenic
1171231042 20:23485423-23485445 TATTATGTGCCAATTTGACTGGG - Intergenic
1171465432 20:25324622-25324644 TGCAATGTGCCACATGGACATGG - Intronic
1174941393 20:54932581-54932603 TGTTATATGCCATTTGAACTGGG + Intergenic
1175492260 20:59387166-59387188 TTTTGTGTGCCAGAAGGACAGGG + Intergenic
1176783824 21:13231714-13231736 TGATATTTTCCTGTTGGACAAGG + Intergenic
1177140780 21:17355564-17355586 TGGTATTTTCCTGTTGGACAAGG - Intergenic
1177195314 21:17898515-17898537 TGATATTTTCCTGTTGGACAAGG + Intergenic
1177981878 21:27925553-27925575 TGATATTTTCCTGTTGGACAAGG + Intergenic
1178059590 21:28836945-28836967 TGATATTTTCCTGTTGGACAAGG - Intergenic
1178959262 21:37049314-37049336 TGATATTTTCCTGTTGGACAAGG - Intergenic
1179194615 21:39153532-39153554 AGCTCTGGGCCAGTTGGACAGGG - Intergenic
1179986721 21:44926281-44926303 TCTGATGTGCCTGTTGCACAAGG + Intronic
1181047318 22:20221616-20221638 TGTGCTGTGGCAGTTGGCCAGGG + Intergenic
1181291445 22:21797063-21797085 TGTTCAGTGCCAGTTGTAAAGGG - Intronic
1182603057 22:31482291-31482313 TGTCACCTGCCAGTTGGACAGGG - Intronic
1183048148 22:35238440-35238462 TGATATTTTCCTGTTGGACAAGG + Intergenic
1183472686 22:38017934-38017956 TGTTATGTGGCAGGAGGGCAGGG - Intronic
950592185 3:13945872-13945894 TGATATTTTCCTGTTGGACAAGG + Intronic
950599009 3:14015153-14015175 TGATATTTTCCTGTTGGACAAGG + Intronic
950751599 3:15133400-15133422 TGTTATGTATCAATTGGACTTGG + Intergenic
951184005 3:19690777-19690799 TGGTATTTTCCTGTTGGACAAGG - Intergenic
951852119 3:27152941-27152963 TGATATTTTCCTGTTGGACAAGG - Intronic
952846903 3:37695453-37695475 TATTCTGTGTCAGTTGCACATGG + Intronic
953819194 3:46189600-46189622 GGATATGTGCCTGTTGGACAAGG + Intronic
953866629 3:46589015-46589037 TGATATTTTCCTGTTGGACAAGG - Intronic
955968598 3:64414000-64414022 TACTATGTGCCATTTGGAAAGGG - Intronic
956507151 3:69954269-69954291 TACTATGTGCCAGATGCACAAGG + Intronic
956584322 3:70848303-70848325 TGTTTTGTGCCAGTTTTAAAAGG + Intergenic
956950472 3:74276073-74276095 TGATATTTTCCTGTTGGACAAGG - Intronic
957331426 3:78769273-78769295 TGATATTTTCCTGTTGGACAAGG + Intronic
957971905 3:87392691-87392713 TGATATTTTCCTGTTGGACAAGG - Intergenic
958003092 3:87776353-87776375 TGATATTTTCCTGTTGGACAAGG + Intergenic
958088097 3:88838925-88838947 TGATATTTTCCTGTTGGACAAGG + Intergenic
958770869 3:98423940-98423962 TGATATTTTCCTGTTGGACAAGG - Intergenic
959006305 3:101024378-101024400 TGTTTTGTTCCAGTTTTACAGGG + Intergenic
959349614 3:105245370-105245392 TGTCATGAGCCAGTTGCATATGG - Intergenic
959715529 3:109429180-109429202 TGATATTTTCCTGTTGGACAAGG + Intergenic
959998285 3:112702157-112702179 TGATATTTTCCTGTTGGACAAGG - Intergenic
960291127 3:115886265-115886287 TTTTATGTGTCAGTTGGACTGGG - Intronic
961407383 3:126690672-126690694 TGATATTTTCCTGTTGGACAAGG - Intergenic
962065800 3:131979396-131979418 TGATATTTTCCTGTTGGACAAGG + Intronic
962764841 3:138552103-138552125 TGATATTTTCCTGTTGGACAAGG - Intronic
962869499 3:139475766-139475788 TGTTTTCTGCCAGTTCCACAGGG + Intronic
963176295 3:142300969-142300991 TGATATTTTCCTGTTGGACAAGG - Intergenic
963556566 3:146796390-146796412 TTTTATGTGTCAGTTTGACTGGG - Intergenic
964160851 3:153643052-153643074 TGATATTTTCCTGTTGGACAAGG - Intergenic
964601035 3:158501560-158501582 TGATATTTTCCTGTTGGACAAGG + Intronic
964644047 3:158938902-158938924 TGATATTTTCCTGTTGGACAAGG - Intergenic
965154230 3:165026261-165026283 TGATATTTTCCTGTTGGACAAGG - Intronic
965874178 3:173297479-173297501 TGATATTTTCCTGTTGGACAAGG + Intergenic
966320134 3:178693317-178693339 TGTTTTGTGCCAGTTGTCAAAGG + Intronic
967257303 3:187607021-187607043 TGATATTTTCCTGTTGGACAAGG + Intergenic
967559153 3:190897758-190897780 TGATATTTTCCTGTTGGACAAGG - Intergenic
967741369 3:193006448-193006470 TGATATTTTCCTGTTGGACAAGG + Intergenic
968125439 3:196156113-196156135 TGGTATTTTCCTGTTGGACAAGG + Intergenic
968720840 4:2202780-2202802 TGATATTTTCCTGTTGGACAAGG - Intronic
969297874 4:6280256-6280278 AGTGATGTGCCAGTGGGCCAGGG + Intronic
969583398 4:8078361-8078383 TGCTATGTGCCAGGTGCATAGGG + Intronic
970019735 4:11554482-11554504 TGCTATGCGCCCTTTGGACAAGG + Intergenic
970307640 4:14749909-14749931 TGTTATTTGCCACATGGAAATGG + Intergenic
970312272 4:14795094-14795116 TGATATTTTCCTGTTGGACAAGG - Intergenic
970477218 4:16435847-16435869 TTTTATGTGTCAGTTTGACTGGG - Intergenic
970549093 4:17161631-17161653 TGATATTTTCCTGTTGGACAAGG + Intergenic
970658415 4:18258239-18258261 TGATATTTTCCTGTTGGACAAGG + Intergenic
971067690 4:23052743-23052765 TGTCATGTGTCAGTTTCACATGG - Intergenic
971733709 4:30418661-30418683 TTTTATGTGTCACTTTGACAAGG + Intergenic
972049018 4:34704573-34704595 TGATATTTTCCTGTTGGACAGGG - Intergenic
973068951 4:45833691-45833713 TGATATTTTCCTGTTGGACAAGG + Intergenic
973179366 4:47249638-47249660 TGATATTTTCCTGTTGGACAAGG + Intronic
973242100 4:47968052-47968074 AGTTCTCTGCCAGTTGGATAAGG + Intronic
973554915 4:52073172-52073194 TATTCTGTGCCTGTTTGACATGG + Intronic
973658722 4:53079434-53079456 TGTTATGTGTCAGCTTGACTTGG - Intronic
973782656 4:54303092-54303114 TGATATTTTCCTGTTGGACAAGG - Intergenic
974327726 4:60436762-60436784 TGATATCTTCCTGTTGGACAAGG + Intergenic
975313031 4:72924886-72924908 TGTTATGAGCCACTTGGAGCTGG + Intergenic
975517507 4:75262602-75262624 TGATATTTTCCTGTTGGACAAGG - Intergenic
976452473 4:85206568-85206590 TGATATTTTCCTGTTGGACAAGG + Intergenic
976556406 4:86455585-86455607 TGATATTTTCCTGTTGGACAAGG - Intronic
976856688 4:89612207-89612229 TGATATTTTCCTGTTGGACAAGG - Intergenic
977510710 4:97958651-97958673 TGATATTTTCCTGTTGGACAAGG - Intronic
977549526 4:98425655-98425677 TGATATTTTCCTGTTGGACAAGG - Intronic
977813678 4:101388402-101388424 TGATATTTTCCTGTTGGACAAGG + Intergenic
977854809 4:101876334-101876356 TGTTCTGTGCCACCTGGACCTGG - Intronic
979434945 4:120676753-120676775 TGATATTTTCCCGTTGGACAAGG - Intergenic
979531775 4:121776023-121776045 TTTTATGTGTCAGTTGGACTGGG + Intergenic
979982978 4:127279297-127279319 TTTTATGTGTCAGTTTGACTGGG + Intergenic
980480526 4:133381293-133381315 TTTTATGTGTCAGTTTGACTTGG + Intergenic
981110643 4:140929678-140929700 TTTTATGTGTCAGTTTGGCAAGG + Intronic
981346898 4:143686254-143686276 TGATATTTTCCTGTTGGACAAGG - Intronic
981461584 4:145018877-145018899 TGGTATTTTCCTGTTGGACAAGG - Intronic
981626194 4:146758268-146758290 TGATATATTCCTGTTGGACAAGG - Intronic
981825056 4:148930550-148930572 TGATATTTTCCTGTTGGACAAGG - Intergenic
982095300 4:151916767-151916789 TGTTATTTACCAGCAGGACAGGG - Intergenic
982119403 4:152127052-152127074 TGATATTTTCCTGTTGGACAAGG + Intergenic
982630848 4:157826991-157827013 TGATATTTTCCTGTTGGACAAGG - Intergenic
982679938 4:158417099-158417121 TGATATTTTCCTGTTGGACAAGG + Intronic
984527346 4:180873476-180873498 TGATATTTTCCTGTTGGACAAGG + Intergenic
984721937 4:182980679-182980701 TGATATTTTCCTGTTGGACAAGG - Intergenic
985240596 4:187927462-187927484 TGATATTTTCCTGTTGGACAAGG + Intergenic
985355949 4:189119087-189119109 TGATATTTTCCTGTTGGACAAGG - Intergenic
986870434 5:12038763-12038785 TGATATTTTCCTGTTGGACAAGG - Intergenic
987577930 5:19754442-19754464 TGATATTTTCCTGTTGGACAAGG - Intronic
987594662 5:19981724-19981746 TGTTATGTGTCAGATAGCCAGGG + Intronic
988383396 5:30529212-30529234 TTTTATGTGTCAGTTTGACTAGG - Intergenic
990017873 5:51088173-51088195 TGTTAGGAACCAGTTGGATACGG - Intergenic
990233551 5:53741280-53741302 TGATATTTTCCTGTTGGACAAGG - Intergenic
990352233 5:54930415-54930437 TGTAATGTAACAGTGGGACATGG + Intergenic
991387210 5:66103285-66103307 TGATATTTTCCTGTTGGACAAGG - Intergenic
991407998 5:66320355-66320377 GGGTATGAGCCAGTGGGACAGGG - Intergenic
991448410 5:66725836-66725858 TGTTATGTGCCGGTTGAAATAGG + Intronic
992030180 5:72713335-72713357 TTTTATGTGTCAGTTTGACTGGG + Intergenic
992348807 5:75908506-75908528 TTTTATGTGCCAGGTGAGCAAGG + Intergenic
993051151 5:82927559-82927581 TGTCATGTGCTAGTTAGAAAAGG - Intergenic
993250130 5:85511321-85511343 TGATATCTTCCTGTTGGACAAGG + Intergenic
993743484 5:91566957-91566979 TGATATTTTCCTGTTGGACAAGG - Intergenic
993883675 5:93392798-93392820 TGATATTTTCCTGTTGGACAAGG + Intergenic
993917267 5:93758175-93758197 TGATATTTTCCTGTTGGACAAGG - Intronic
993964992 5:94349224-94349246 TGATATTTTCCTGTTGGACAAGG - Intronic
994330082 5:98494256-98494278 TGATATATTCCTGTTGGACAAGG - Intergenic
995271718 5:110227683-110227705 TCTTATGCCCCAGTTTGACAGGG - Intergenic
995722723 5:115153316-115153338 TGATATTTTCCTGTTGGACAAGG - Intronic
996678546 5:126204265-126204287 TGATATTTTCCTGTTGGACAAGG - Intergenic
997105761 5:131017785-131017807 TGATATTTTCCTGTTGGACAAGG + Intergenic
997761139 5:136448512-136448534 TGATATTTTCCTGTTGGACAAGG - Intergenic
998171483 5:139874399-139874421 TGGTTTGTGCCATTTGGTCACGG - Intronic
998903908 5:146883034-146883056 TTTAATGTGCTAATTGGACAGGG - Intronic
999484483 5:151981878-151981900 TGTTATTTTCCTATTGGACAAGG + Intergenic
999861327 5:155649830-155649852 TGTTTTGTGCCAGTTGGAAGAGG + Intergenic
1000779961 5:165467610-165467632 TGATATTTTCCTGTTGGACAAGG - Intergenic
1001166882 5:169376857-169376879 TGATATTTTCCTGTTGGACAAGG - Intergenic
1001896382 5:175385413-175385435 TGTTGGGTGGCACTTGGACAAGG - Intergenic
1003415457 6:5903584-5903606 TGATATGGGCTAGTTGGAGATGG - Intergenic
1003451097 6:6232381-6232403 TGATATTTTCCTGTTGGACAAGG - Intronic
1003711765 6:8600771-8600793 TGATATTTCCCTGTTGGACAAGG + Intergenic
1003739081 6:8914124-8914146 TGTTATGTGTAAGTTGCATATGG - Intergenic
1005072715 6:21876622-21876644 TGATATTTTCCTGTTGGACAAGG - Intergenic
1005737318 6:28760055-28760077 TGTTTTCTGCCAGTTCTACAAGG - Intergenic
1007608798 6:43135457-43135479 TTTTAGGTGCCAGTAGAACAAGG + Intronic
1007891108 6:45292764-45292786 TGATATTTTCCTGTTGGACAAGG - Intronic
1007892922 6:45312562-45312584 TGATATTTTCCTGTTGGACAAGG - Intronic
1007964716 6:45993652-45993674 TGTTATGTGAAAGTTTGTCAGGG - Intronic
1008190468 6:48450463-48450485 TGATATTTTCCTGTTGGACAAGG + Intergenic
1008413304 6:51208585-51208607 TGTTATGTGCCAACTTGACTGGG - Intergenic
1008649147 6:53545395-53545417 TATTATGTTTTAGTTGGACAGGG + Intronic
1008736053 6:54545529-54545551 TGATATTTTCCTGTTGGACAAGG + Intergenic
1008973366 6:57396362-57396384 TGATATTTTCCTGTTGGACAAGG + Intronic
1009453385 6:63827202-63827224 TGATATTTTCCTGTTGGACAAGG - Intronic
1009585417 6:65595314-65595336 TGTTGTGTGGTAGGTGGACAGGG + Intronic
1010008793 6:71026897-71026919 TGATATTTTCCTGTTGGACAAGG + Intergenic
1010512324 6:76735987-76736009 TGTCTTGTGCCAGTTGTAAAAGG - Intergenic
1010591366 6:77716800-77716822 TGTCATGTGGAAGTTGAACAAGG + Intronic
1011132918 6:84070776-84070798 TGATATTTTCCTGTTGGACAAGG + Intronic
1011156442 6:84338854-84338876 TGATATTTTCCTGTTGGACAAGG + Intergenic
1011321006 6:86093435-86093457 TGATATTTTCCTGTTGGACAAGG + Intergenic
1011328866 6:86181888-86181910 TGATATTTTCCTGTTGGACAAGG + Intergenic
1011366721 6:86590472-86590494 TGTTATGTGTCAGTTTGACTGGG + Intergenic
1011789512 6:90883505-90883527 TGATATTTTCCTGTTGGACAAGG + Intergenic
1012156171 6:95821968-95821990 TGTTATTTTCCTGTTGGACAAGG - Intergenic
1012210776 6:96516347-96516369 TTTTATGTGTCAGTTTGACTGGG + Intergenic
1012684783 6:102232402-102232424 TGATATTTTCCTGTTGGACAAGG + Intergenic
1012786413 6:103633880-103633902 TGATATTTTCCTGTTGGACAAGG - Intergenic
1012794006 6:103736694-103736716 TGATATTTTCCTGTTGGACAAGG - Intergenic
1013048024 6:106507275-106507297 TGCTCCGTCCCAGTTGGACATGG + Intergenic
1013720853 6:113026608-113026630 TGATATTTTCCTGTTGGACAAGG + Intergenic
1013947463 6:115737924-115737946 TGTGATGTGTCAGTTTGACTGGG - Intergenic
1014119052 6:117702080-117702102 TGTTATTTCCCAGTCGGCCATGG + Intronic
1014285252 6:119489599-119489621 TGATATTTTCCTGTTGGACAAGG - Intergenic
1014304632 6:119725490-119725512 TGATATCTTCCTGTTGGACAAGG + Intergenic
1014337039 6:120149478-120149500 TGATATTTTCCTGTTGGACAAGG - Intergenic
1014739247 6:125127878-125127900 TGATATTTTCCTGTTGGACAAGG - Intronic
1015222358 6:130818697-130818719 TGATATTTTCCTGTTGGACAAGG - Intergenic
1015663098 6:135598433-135598455 TGATATTTTCCTGTTGGACAAGG + Intergenic
1015837312 6:137434356-137434378 TGTTGTCTCCCAGTTCGACAGGG + Intergenic
1015849546 6:137557848-137557870 TGATATTTTCCTGTTGGACAAGG + Intergenic
1016680675 6:146825698-146825720 TGTTATATACCAGATGGAAAAGG - Intergenic
1016863000 6:148740259-148740281 TGTAATGTGCCCATTGAACAAGG + Intergenic
1017297311 6:152812867-152812889 TGATAAATGCCAGTTGGTCATGG + Intergenic
1018009615 6:159657722-159657744 TGATAGTTTCCAGTTGGACAAGG - Intergenic
1018281228 6:162187761-162187783 TGCTATCTGCCAGGAGGACATGG + Intronic
1020348841 7:7195881-7195903 TGATATTTTCCTGTTGGACAAGG + Intronic
1021204500 7:17763828-17763850 TGATATTTTCCTGTTGGACAAGG - Intergenic
1021571325 7:22068122-22068144 TGCTCTGTGTGAGTTGGACAAGG - Intergenic
1022811878 7:33877039-33877061 TTTTATGTGACAGGTTGACATGG + Intergenic
1024304683 7:47918289-47918311 TGATATTTTCCTGTTGGACAAGG - Intronic
1024917863 7:54524399-54524421 TGATATTTTCCTGTTGGACAAGG + Intergenic
1027197309 7:76039550-76039572 TCTTCTGTGCCAGTGGGACCTGG - Intronic
1027204445 7:76086333-76086355 AGCTATTTGCCAGTGGGACATGG - Intergenic
1027328775 7:77069396-77069418 TGATATTTTCCTGTTGGACAAGG + Intergenic
1027699434 7:81451354-81451376 TGGTATTTTCCTGTTGGACAAGG - Intergenic
1029786997 7:102801969-102801991 TGATATTTTCCTGTTGGACAAGG - Intronic
1030497061 7:110313724-110313746 TTTTATGTGTCAGCTGGACTGGG + Intergenic
1030844532 7:114392834-114392856 TGGAATGTGCCAGTTGGTTAAGG + Intronic
1030918329 7:115345928-115345950 TGTTATCTGACAGTTGTAGAAGG + Intergenic
1032045041 7:128598906-128598928 TTTTTGGTGCCAGTTGGTCACGG + Intergenic
1032289495 7:130575998-130576020 TGATATTTTCCTGTTGGACAAGG - Intronic
1032403733 7:131641129-131641151 TCTTATGTGTCAGATGGACCAGG + Intergenic
1032896194 7:136253292-136253314 TGATATTTTCCTGTTGGACAAGG - Intergenic
1032922426 7:136565019-136565041 TGATATTTTCCTGTTGGACAAGG + Intergenic
1033566044 7:142579113-142579135 TGTTACGTGAGAGTGGGACAGGG + Intergenic
1035893347 8:3370502-3370524 GGTTATGTGCCAGTGTGACTGGG + Intronic
1036108593 8:5873201-5873223 TGTTATTTTCCTGTTGGATAAGG + Intergenic
1036154328 8:6327714-6327736 TTTTATGTGTCAGTTTGACTGGG - Intergenic
1037601013 8:20394020-20394042 TGTGATCTCACAGTTGGACAGGG + Intergenic
1037966210 8:23135653-23135675 TGTTATGTGCTATTTGGCCCGGG + Exonic
1038237282 8:25771469-25771491 TGATATTTTCCTGTTGGACAAGG - Intergenic
1039083085 8:33753383-33753405 TGATATTTTCCTGTTGGACAAGG + Intergenic
1041637330 8:60158484-60158506 TGATATTTTCCTGTTGGACAAGG - Intergenic
1041698467 8:60762250-60762272 TGTTATGTGCCAGAAGCTCAGGG - Intronic
1041877764 8:62710431-62710453 TGATATTTTCCTGTTGGACAAGG + Intronic
1042088817 8:65135888-65135910 TGATATTTTCCTGTTGGACAAGG - Intergenic
1043040990 8:75261615-75261637 TGATATTTTCCTGTTGGACAAGG - Intergenic
1043048875 8:75360434-75360456 TGGTATTTTCCTGTTGGACAAGG - Intergenic
1043121465 8:76330722-76330744 TGATATTTTCCTGTTGGACAAGG + Intergenic
1043371553 8:79599763-79599785 TGTTATGTGTCAATTTGACTGGG + Intergenic
1043816671 8:84810698-84810720 TGATATTTTCCTGTTGGACAAGG + Intronic
1044180364 8:89186140-89186162 TTTTATGTGTCAGTTTGACTAGG + Intergenic
1044907447 8:97019653-97019675 TGATATTTTCCTGTTGGACAAGG - Intronic
1045095056 8:98788696-98788718 TGATATTTTCCTGTTGGACAAGG - Intronic
1045780034 8:105851801-105851823 TGATATTTTCCTGTTGGACAAGG - Intergenic
1046394807 8:113627563-113627585 TGATATTTTCCTGTTGGACAAGG - Intergenic
1046813331 8:118556463-118556485 TGTCATTTGCCAGTTGGAAAAGG - Intronic
1048126692 8:131643291-131643313 TGTCATCTGCCAGTTGGGCTGGG + Intergenic
1049869520 8:144963369-144963391 TGATATTTTCCTGTTGGACAAGG + Intergenic
1049956199 9:695423-695445 TGGTATGTACCAGTTAGATAAGG - Intronic
1050147595 9:2585631-2585653 TGATATTTTCCTGTTGGACAAGG - Intergenic
1052550060 9:29936918-29936940 TGATATTTTCCTGTTGGACAAGG + Intergenic
1052731260 9:32289263-32289285 TGATATTTTCCTGTTGGACAAGG + Intergenic
1054707410 9:68477053-68477075 TGTTTTTTGGCAGTTGGCCATGG + Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055905587 9:81290472-81290494 TGGTATTTTCCTGTTGGACAAGG + Intergenic
1056261831 9:84856425-84856447 GATTATGTGCCAGTAGGAAAGGG + Intronic
1056943921 9:90977771-90977793 TGTTATGTGTCAATTTGACGGGG - Intergenic
1057004034 9:91539980-91540002 TGATATTTTCCTGTTGGACAAGG - Intergenic
1057084512 9:92196733-92196755 TGTTATGGGCCACTGTGACAGGG - Intergenic
1057119242 9:92556544-92556566 TGATATTTTCCTGTTGGACAAGG + Intronic
1058156524 9:101522425-101522447 TGATATTTTCCTGTTGGACAAGG + Intronic
1058770877 9:108230293-108230315 TGATATTTTCCTGTTGGACAAGG - Intergenic
1058802336 9:108556861-108556883 TTTTATGTGCCAGCTGTAGAGGG - Intergenic
1060952061 9:127610358-127610380 TGATATGTGCCAGCTGGCGAAGG + Intergenic
1062406477 9:136399256-136399278 GGTTTTGTTCCAGTTGGGCAGGG - Intergenic
1062713807 9:137992367-137992389 TGATATTTTCCTGTTGGACAAGG - Intronic
1186555670 X:10555859-10555881 TCTTCTGTGCCAGTTGTGCAGGG - Intronic
1187218987 X:17305817-17305839 TGATATTTTCCTGTTGGACAAGG + Intergenic
1187681597 X:21772555-21772577 TGATATTTTCCTGTTGGACAAGG - Intergenic
1187748919 X:22439837-22439859 TGATATTTTCCTGTTGGACAAGG - Intergenic
1187773388 X:22728535-22728557 TGATATTTTCCTGTTGGACAAGG + Intergenic
1188040317 X:25364304-25364326 TGATATTTTCCTGTTGGACAAGG + Intergenic
1188045679 X:25424060-25424082 TGATATTTTCCTGTTGGACAAGG + Intergenic
1188702966 X:33288176-33288198 TGTAATATCCCAGTTGAACAGGG + Intronic
1189413875 X:40796850-40796872 TGATATTTTCCTGTTGGACAAGG - Intergenic
1189603362 X:42650549-42650571 TGATATTTTCCTGTTGGACAAGG - Intergenic
1190029945 X:46962414-46962436 TTTCATGTGCCATTTGTACACGG - Intronic
1190520455 X:51273943-51273965 TTTTATGTGGCAGTTTGACTAGG + Intergenic
1190631989 X:52396898-52396920 TGATATTTTCCTGTTGGACAAGG + Intergenic
1190751413 X:53364969-53364991 TGGCATGTGCCAGTAGGATAAGG - Intergenic
1190895264 X:54612133-54612155 TGATATTTTCCTGTTGGACAAGG + Intergenic
1191067492 X:56366138-56366160 TGATATTTTCCTGTTGGACAAGG + Intergenic
1191806847 X:65145183-65145205 TGGTATTTTCCTGTTGGACAAGG + Intergenic
1191954367 X:66627560-66627582 TGATATTTTCCTGTTGGACAAGG - Intronic
1192014416 X:67313990-67314012 TGATATTTTCCTGTTGGACAAGG + Intergenic
1192590331 X:72354345-72354367 TGTTGTGAGCCAGTTCTACATGG + Intronic
1192987022 X:76410728-76410750 TGATATTTTCCTGTTGGACAAGG - Intergenic
1193077227 X:77366976-77366998 TGATATTTTCCTGTTGGACAAGG - Intergenic
1193157104 X:78185594-78185616 TGATATTTACCTGTTGGACAAGG - Intergenic
1193208527 X:78777855-78777877 TGATATTTTCCTGTTGGACAAGG + Intergenic
1193216060 X:78865952-78865974 TGTCTTGTGCCAGTTTGAAAAGG + Intergenic
1193330904 X:80234389-80234411 TGTTATTTTCCAGTAGGCCAAGG - Intergenic
1193578727 X:83234804-83234826 TGATATTTTCCTGTTGGACAAGG - Intergenic
1193785811 X:85758606-85758628 TGATATTTTCCTGTTGGACAAGG + Intergenic
1194492438 X:94568429-94568451 TGTTGTGTTCCACTGGGACAAGG + Intergenic
1194619173 X:96147529-96147551 TTTTATGTCTCAGTTGGACTGGG - Intergenic
1194839216 X:98718003-98718025 TATTATGTGTCAATTTGACAAGG + Intergenic
1195015921 X:100780652-100780674 TGATATTTCCCTGTTGGACAAGG + Intergenic
1195076318 X:101330228-101330250 TGATATTTGCCTGTTGAACAAGG - Intergenic
1195795671 X:108644165-108644187 TGATATTTTCCTGTTGGACAAGG - Intronic
1196675543 X:118416899-118416921 TGATATTTTCCTGTTGGACAAGG + Intronic
1196737773 X:118994767-118994789 TGATATTTTCCTGTTGGACAAGG - Intronic
1197504117 X:127280346-127280368 TGATATTTTCCTGTTGGACAAGG - Intergenic
1197519126 X:127475149-127475171 TGATATTTTCCTGTTGGACAAGG - Intergenic
1197589111 X:128386216-128386238 TGATATTTTCCTGTTGGACAAGG - Intergenic
1197911195 X:131484094-131484116 TGATATTTCCCTGTTGGACAAGG - Intergenic
1199206127 X:145150462-145150484 TGATATTTTCCTGTTGGACAAGG - Intergenic
1199521287 X:148739328-148739350 TGTTATTTTCCTGTTGGATAAGG + Intronic
1199821554 X:151454208-151454230 TGATATTTTCCTGTTGGACAAGG - Intergenic
1201246529 Y:12009445-12009467 TGTTTTGTGCCAGTTTTCCAAGG + Intergenic
1201523959 Y:14910301-14910323 TTTTATGTATCAGTTCGACATGG - Intergenic
1202106275 Y:21370363-21370385 TTTTATGTGTCAGTTTGACTGGG + Intergenic
1202201337 Y:22353447-22353469 TTTTATGTGTCAGTTTGACTGGG - Intronic