ID: 1155515381

View in Genome Browser
Species Human (GRCh38)
Location 18:26619580-26619602
Sequence CTGGCTGTCGACAGCTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155515380_1155515381 -5 Left 1155515380 18:26619562-26619584 CCACGTGTTTGGGGGATGCTGGC 0: 1
1: 0
2: 1
3: 10
4: 95
Right 1155515381 18:26619580-26619602 CTGGCTGTCGACAGCTATTCAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1155515378_1155515381 1 Left 1155515378 18:26619556-26619578 CCATAGCCACGTGTTTGGGGGAT 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1155515381 18:26619580-26619602 CTGGCTGTCGACAGCTATTCAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155515381 Original CRISPR CTGGCTGTCGACAGCTATTC AGG Intronic
903651302 1:24923809-24923831 CTGTGTGTCGACAGAGATTCGGG - Intronic
906610856 1:47201288-47201310 CTGGCTGTGGACAGATTCTCTGG - Intergenic
906786436 1:48619956-48619978 CTGGCTGTCGTCAGCCCTTAGGG + Intronic
910803821 1:91170875-91170897 CTGGCTTTGGACAGCGCTTCAGG - Intergenic
912449590 1:109760890-109760912 CTTGGTGTCGACAGCCCTTCAGG + Intronic
1071957609 10:90776861-90776883 CTGTATGTGGACAGCTATTATGG - Intronic
1072756862 10:98027233-98027255 CTGGCTGTCGACATCTGAGCTGG - Intronic
1073969432 10:109030563-109030585 CTGGCAGACTACAGCTATTGTGG + Intergenic
1080007175 11:27422030-27422052 CTGGGTGTCAACAGCTGTTCTGG + Intronic
1080590885 11:33722378-33722400 CTGGCTGTCTTCTGCCATTCAGG - Exonic
1090667831 11:128926638-128926660 CTGTCTGCGGAGAGCTATTCTGG + Intergenic
1092104190 12:5909497-5909519 CTGGATCTCGACTTCTATTCTGG - Intronic
1094499923 12:31012191-31012213 CTGGCTGTGCACCGCTATTTTGG + Intergenic
1109249747 13:60005110-60005132 CTGTCAGTCGACAGACATTCAGG - Intronic
1115828812 14:37310975-37310997 CAAGCTTTTGACAGCTATTCAGG - Intronic
1127383817 15:58451568-58451590 CTGCCTGTGGCCATCTATTCAGG - Intronic
1129458327 15:75687528-75687550 CTCGCTGGGGACAGCTAGTCCGG - Exonic
1129725455 15:77899337-77899359 CTCGCTGGGGACAGCTACTCTGG + Intergenic
1138423654 16:56916264-56916286 CTGGCTGGGGACACCTGTTCTGG - Intergenic
1143999698 17:11041513-11041535 CTGGCTTTGTACAGCTAATCAGG + Intergenic
1148483254 17:47974348-47974370 GTGGCTGTCGAGTGCTTTTCTGG + Intronic
1148860452 17:50601776-50601798 TTCGCTGTCGGCAGCAATTCTGG + Intronic
1155515381 18:26619580-26619602 CTGGCTGTCGACAGCTATTCAGG + Intronic
1168033513 19:53700553-53700575 ATGCCTGTAGACAGCTATTCAGG - Intergenic
1168034305 19:53706798-53706820 ATGCCTGCAGACAGCTATTCAGG - Intergenic
1168041364 19:53761687-53761709 ATGCCTGTAGACAGGTATTCAGG - Intergenic
1168474345 19:56665087-56665109 CTGGCTCTGGACAGCTTTCCTGG + Exonic
926386326 2:12339059-12339081 CTGGCTGTCTACAGCTGTCCAGG - Intergenic
927841045 2:26444442-26444464 CTTGATGTCACCAGCTATTCTGG + Intronic
928254762 2:29712472-29712494 CTGGCTGTGATCAGCCATTCTGG - Intronic
929401457 2:41586727-41586749 CTGGCTGGCTTAAGCTATTCTGG + Intergenic
940778830 2:157911687-157911709 CTAGCTGTTGACAGCAATTCAGG - Intronic
951105353 3:18735745-18735767 CCGGCTTTCTTCAGCTATTCAGG - Intergenic
951765139 3:26189549-26189571 CTGAGTGTCCACAGATATTCCGG + Intergenic
953342619 3:42148290-42148312 CTTGCTGTGGAAGGCTATTCTGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
960178161 3:114542010-114542032 CTGGATGTCTACAGGTATTTTGG + Intronic
963493621 3:146032646-146032668 AAGGCTGTCTACAGCAATTCTGG - Intergenic
987379271 5:17269579-17269601 CTGGCTAGAAACAGCTATTCTGG - Intronic
988487791 5:31680943-31680965 CTGACTGTGGACACCCATTCTGG + Intronic
1007929587 6:45678342-45678364 CTGGCTGTGGACAGCATTTCAGG + Intergenic
1012471315 6:99575796-99575818 CTGGCTGAAGATAGCTACTCTGG + Intergenic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1019082957 6:169448538-169448560 CCGGCTTCCGACAGCTATTTCGG - Intergenic
1030587263 7:111435914-111435936 CTGGCTGTCTACATCTATAGGGG - Intronic
1033163442 7:139017447-139017469 CAGGCTGTAGAAAGCAATTCTGG - Intergenic
1035574270 8:695160-695182 CTGGCAGCCGACAGCTATGGAGG + Intronic
1038578598 8:28727233-28727255 CTGGATGACAACAGCTGTTCAGG - Intronic
1039839626 8:41284562-41284584 CTGGCTGTTGTCAGCCATGCTGG - Intronic
1042999941 8:74745704-74745726 GTGGATGGCTACAGCTATTCTGG + Intronic
1045193288 8:99904562-99904584 CTGGGTGTGGCCAGCTACTCAGG - Intergenic
1056824676 9:89868656-89868678 CTGGTTGTGCACAGCTTTTCAGG - Intergenic
1061372918 9:130207882-130207904 CTGGCTGTGGACACCAATGCCGG - Intronic
1186419868 X:9417033-9417055 CTGTCATTCTACAGCTATTCAGG - Intergenic
1187594456 X:20756082-20756104 TTGGCTTTCGACAGCATTTCTGG - Intergenic
1190929232 X:54934175-54934197 CTGGCTGCCCACAGCTCTTGAGG + Intronic
1192190763 X:68989960-68989982 CTGGCACTCGACAGCCACTCTGG + Intergenic
1192436598 X:71147232-71147254 CTGGCTGTCACATGCTATTCTGG + Intronic
1193679692 X:84502666-84502688 CTCGGTGTTCACAGCTATTCAGG - Intergenic
1194483637 X:94458377-94458399 CTGAGTGTCAACAGCTACTCAGG + Intergenic
1194733117 X:97479431-97479453 CTGGCAGTCAAAAGCAATTCTGG - Intronic
1196892416 X:120304293-120304315 CTTGCTGTCTACAGAAATTCTGG - Intronic