ID: 1155515843

View in Genome Browser
Species Human (GRCh38)
Location 18:26623383-26623405
Sequence CCCATGACACGTGTGTATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 4, 3: 85, 4: 898}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155515843_1155515851 11 Left 1155515843 18:26623383-26623405 CCACGATACACACGTGTCATGGG 0: 1
1: 0
2: 4
3: 85
4: 898
Right 1155515851 18:26623417-26623439 AGGATGTAATTGAATCATGGGGG 0: 4
1: 342
2: 4219
3: 7751
4: 10153
1155515843_1155515847 -9 Left 1155515843 18:26623383-26623405 CCACGATACACACGTGTCATGGG 0: 1
1: 0
2: 4
3: 85
4: 898
Right 1155515847 18:26623397-26623419 TGTCATGGGAGGGACTCAGTAGG 0: 32
1: 687
2: 1535
3: 3621
4: 5482
1155515843_1155515850 10 Left 1155515843 18:26623383-26623405 CCACGATACACACGTGTCATGGG 0: 1
1: 0
2: 4
3: 85
4: 898
Right 1155515850 18:26623416-26623438 TAGGATGTAATTGAATCATGGGG 0: 5
1: 275
2: 3899
3: 7639
4: 11391
1155515843_1155515849 9 Left 1155515843 18:26623383-26623405 CCACGATACACACGTGTCATGGG 0: 1
1: 0
2: 4
3: 85
4: 898
Right 1155515849 18:26623415-26623437 GTAGGATGTAATTGAATCATGGG 0: 4
1: 296
2: 3839
3: 7560
4: 10918
1155515843_1155515848 8 Left 1155515843 18:26623383-26623405 CCACGATACACACGTGTCATGGG 0: 1
1: 0
2: 4
3: 85
4: 898
Right 1155515848 18:26623414-26623436 AGTAGGATGTAATTGAATCATGG 0: 3
1: 120
2: 2103
3: 6338
4: 9247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155515843 Original CRISPR CCCATGACACGTGTGTATCG TGG (reversed) Intronic
900618369 1:3575785-3575807 CCCATGACACGTGGGAATTATGG + Intronic
900749519 1:4386116-4386138 CCCATGACAAGTGGGAATTGTGG - Intergenic
900822909 1:4903095-4903117 CCCATGACATGTGAGAATTGTGG + Intergenic
900824856 1:4918321-4918343 CCCATGACATGTGGGAATTGTGG + Intergenic
900825122 1:4920242-4920264 CCCATGACACATGGGAATGGTGG + Intergenic
901105016 1:6748553-6748575 CCCCTGACACGTGGGGATCACGG - Intergenic
901312638 1:8281431-8281453 CCCATGACACGTGGGGATTATGG - Intergenic
902153371 1:14462851-14462873 CCCATGACACGTGGAAATTGTGG + Intergenic
902235125 1:15052456-15052478 CCCATGACACGTGGGGATTATGG + Intronic
902931749 1:19736347-19736369 CCCATGACCCATGTGGATTGTGG + Intronic
902939711 1:19791894-19791916 CCCATGACATGTGGGAATTGTGG - Intronic
903591847 1:24462248-24462270 CCCATGACACATGGGGATTGTGG + Intronic
903595151 1:24488452-24488474 CCCATGACACGTGGGAATTATGG + Intergenic
904367238 1:30021399-30021421 CCCATGACATGTGGGGATCATGG + Intergenic
905928379 1:41768397-41768419 CCCATGACACATGGGAATTGTGG + Intronic
906369753 1:45242596-45242618 CCCATGACATGTGGGAATTGTGG + Intronic
907742084 1:57176485-57176507 CCCATGACACATGGGAATTGTGG + Intronic
907814311 1:57903161-57903183 CCCATGACACGTGGGAATTATGG + Intronic
908549806 1:65197091-65197113 CCCATGACACGTGGGAATTGTGG + Intronic
908553965 1:65238242-65238264 CCCATGACACGTGGGGATTATGG + Intergenic
908808219 1:67952571-67952593 CACATGTGACGTGTGTATCTTGG + Intergenic
909185525 1:72481233-72481255 CCCATGACATGTGGGAATTGTGG + Intergenic
909192713 1:72573850-72573872 CCCATGACACGTGTGAATTGTGG - Intergenic
909251035 1:73356597-73356619 CCCATGACACGTGGGAATTATGG + Intergenic
909357681 1:74727752-74727774 CCCATGACACGTGGGAATTATGG + Intronic
910129751 1:83889319-83889341 CCCATGACACGTGGGGATTATGG + Intronic
910256277 1:85250186-85250208 CCCATGACACGTGGGAATTGTGG + Intronic
910472800 1:87573106-87573128 CCCATGACACATGGGGATTGTGG + Intergenic
910747209 1:90587062-90587084 CCCATGACACGTGAGAATTTTGG + Intergenic
911500726 1:98681279-98681301 CCCATGACACATGGGAATCGTGG + Intronic
912024657 1:105153582-105153604 CCCATGACAGGTGGGAATTGTGG + Intergenic
912051945 1:105541123-105541145 CCCATGACACGTGGGTATTATGG + Intergenic
912555213 1:110511046-110511068 CCCATGACACGTGGGAATTATGG - Intergenic
914388611 1:147197466-147197488 CCCATGACACATGGGGATTGTGG - Intronic
915752485 1:158224581-158224603 CCCATGACAGGTGGGAATTGTGG - Intergenic
916318624 1:163478531-163478553 CCCATGACACATGGGAATTGTGG - Intergenic
916691127 1:167190852-167190874 CCCATGACACGTGGGAATTGTGG - Intergenic
916791317 1:168127778-168127800 CCCATGACACATGGGAATTGTGG + Intronic
916959059 1:169871232-169871254 CCCAGGACACGTGGGAATTGTGG - Intronic
916959342 1:169873119-169873141 CCCATGACACATGGGAATTGTGG - Intronic
917107190 1:171503999-171504021 CCCATGACATGTGGGAATTGAGG + Intronic
917167571 1:172129737-172129759 CCCATGACACATGGGAATTGTGG + Intronic
918203958 1:182292591-182292613 CCCATGACACGTGGGAATTATGG + Intergenic
918409692 1:184245579-184245601 CCCATGACACGTGGGAATTTTGG + Intergenic
918619373 1:186584518-186584540 CCCATGACACGTGGGAATTATGG - Intergenic
918686505 1:187422343-187422365 CCCATGACACATGGGTATTATGG + Intergenic
918969786 1:191398571-191398593 CCCATGACATGTGAGAATTGTGG - Intergenic
919156947 1:193777175-193777197 CCCATGACACATGGGAATTGTGG + Intergenic
920783824 1:209021027-209021049 CCCATGACACATGGGAATTGTGG - Intergenic
920952715 1:210587446-210587468 CCCATGACACGTGGGGATTATGG + Intronic
920964078 1:210687872-210687894 CCCATGGCAAGAGTGTATCCTGG + Intronic
921610523 1:217207381-217207403 CCCATGACACATGGGAATTGCGG - Intergenic
921628050 1:217400436-217400458 CCCATCACATGTGTGTATACTGG - Intergenic
921763040 1:218939459-218939481 CCCATGACACATGGGAATTGTGG - Intergenic
922015281 1:221638853-221638875 CCCATGACACATGGGAATTGTGG + Intergenic
922359764 1:224810723-224810745 CCCATGACACTTGGGAATTGTGG - Intergenic
922726789 1:227926490-227926512 CCCATGTCACCTGTCTATCCTGG + Intronic
923249145 1:232163240-232163262 CCCATGACACGTGGGGATTATGG + Intergenic
923311812 1:232742851-232742873 CCCATGACACATGGGAATTGTGG - Intergenic
923414655 1:233744379-233744401 CCCATGACAGGTGGGAATTGTGG - Intergenic
923457491 1:234177026-234177048 CCCATGACATGTGGGAATTGTGG - Intronic
923517292 1:234708547-234708569 CCCATGACACATGGGAATTGTGG + Intergenic
924757519 1:246954994-246955016 CCCATGACACGTGGGGATTATGG - Intronic
1062859421 10:798633-798655 CCCATGACACATGGGGATTGTGG + Intergenic
1063025209 10:2171239-2171261 CCCATGACATGTGGGAATTGTGG + Intergenic
1063133960 10:3200524-3200546 CCCATGACGCATGGGAATCGTGG + Intergenic
1063211164 10:3882522-3882544 CCCATGACACGTGGGGATTATGG + Intergenic
1063966206 10:11347877-11347899 CCCATGACATGTGGGAATTGTGG + Intergenic
1064338140 10:14462279-14462301 CCCATGACACGTGAGAATTATGG + Intergenic
1064500245 10:15963575-15963597 TCCATGACACGTGTGAATGGTGG + Intergenic
1064793617 10:18987644-18987666 CCCATGACATGTGGGAATCATGG + Intergenic
1064929949 10:20614007-20614029 CCCATGACACGTGGGAATTATGG - Intergenic
1065036920 10:21648971-21648993 CCCATGACACGTGGGGATTGTGG + Intronic
1065094344 10:22265858-22265880 CCCATGACATGTGGGAATTGTGG - Intergenic
1065505807 10:26429075-26429097 CCCATGACATGTGGGGATTGTGG + Intergenic
1065638121 10:27752129-27752151 CCCATGACACGTGGGAATTGTGG - Intergenic
1065868264 10:29933041-29933063 CCCATGACACGTGGGGATTCTGG + Intergenic
1065871926 10:29963110-29963132 CCCATGACAAGTGTGGATTATGG - Intergenic
1065892354 10:30132045-30132067 CCCAGGGCACGTGTGTCTGGCGG - Intergenic
1066193921 10:33080341-33080363 CCCATGACACGTGGGAATTATGG - Intergenic
1066318812 10:34278483-34278505 CCCATGACACGTGGGGATTATGG - Intronic
1066679170 10:37919883-37919905 CCCATGACACGTGGGGATTATGG + Intergenic
1067205952 10:44214151-44214173 CCCATGACATGTGGGAATGGTGG - Intergenic
1067352598 10:45490166-45490188 CCCATGATAGTTGTGTATCAGGG - Intronic
1067814547 10:49463642-49463664 CCCATGTCACGTGGGAATTGTGG - Intronic
1067814825 10:49465586-49465608 CCCATGACATGTGGGAATTGTGG - Intronic
1067974792 10:51012077-51012099 CCCGTGACATGTGTGAATTGTGG + Intronic
1068198706 10:53753437-53753459 CCCATGACACGTGAGAATTATGG + Intergenic
1068288092 10:54965273-54965295 CCCATGACACTTGTGGATAATGG - Intronic
1068625308 10:59239457-59239479 CCCATGACATGTGGGAATTGTGG + Intronic
1068653832 10:59554186-59554208 CCCATGACATGTGGGAATTGTGG - Intergenic
1068824900 10:61425276-61425298 CCCATGACACCTGGGAATTGTGG + Intronic
1069040934 10:63694664-63694686 CCCATGACATGTGGGAATTGTGG - Intergenic
1069156807 10:65039672-65039694 CCCACGACACGTGGGAATCATGG - Intergenic
1069189145 10:65465922-65465944 CCCATGACACGTGGGAATTGTGG - Intergenic
1069239529 10:66122923-66122945 CCCATGACATGTGGGAATTGAGG + Intronic
1069339996 10:67398690-67398712 CCCATGACACGTGGGGATTATGG - Intronic
1069351202 10:67529855-67529877 CCCATGACACTTGGGAATTGTGG - Intronic
1069663174 10:70137358-70137380 CCCATGACACGTGGGAATTGTGG + Intergenic
1070413389 10:76165813-76165835 CCCACAACACGTGTGGATAGTGG + Intronic
1070524037 10:77279693-77279715 CCCATGACATGTGGGAATTGTGG - Intronic
1070637760 10:78142783-78142805 CCCATGACACGTGGGGATTATGG - Intergenic
1071776836 10:88798462-88798484 CCAATGACACGTGGGAATTGTGG + Intergenic
1071937147 10:90544705-90544727 CCCATGACACATGGGAATTGTGG + Intergenic
1073734090 10:106326348-106326370 CCCATGATACGTGAGAATTGTGG + Intergenic
1073818561 10:107234355-107234377 CCCATGACAGGTGGGAATTGTGG - Intergenic
1073846863 10:107567210-107567232 CCCATGACATGTGGGAATTGTGG + Intergenic
1074223478 10:111461084-111461106 CCCATGACACATGGGAATTGTGG - Intergenic
1074302949 10:112249466-112249488 CCCATGACACGTGGGGATTATGG - Intergenic
1074411748 10:113234652-113234674 CCCATGACACATGGGAATTGTGG - Intergenic
1074534930 10:114321955-114321977 CCCATGACACGTGAGAATTATGG - Intronic
1074726572 10:116316209-116316231 CCCATGACACATGGGGATTGTGG - Intergenic
1075371534 10:121940063-121940085 CCCATGACACGTGGGGATTATGG - Intergenic
1075593926 10:123713655-123713677 CCCATGACACATGGGAATTGTGG + Intronic
1075655475 10:124158297-124158319 CCCATGACACGTGGGAATTGCGG + Intergenic
1075895483 10:125991018-125991040 CCCATGACACATGTGAATTATGG + Intronic
1076101154 10:127779755-127779777 CCCATGACATGTGGGAATTGTGG - Intergenic
1076125033 10:127967334-127967356 CCCATGACACGTGGGGATTATGG - Intronic
1076155560 10:128202533-128202555 CCCATGACATGTGGGAATTGTGG + Intergenic
1076576042 10:131468865-131468887 CCCATGACACGTGAGGATTGTGG + Intergenic
1077193224 11:1264705-1264727 CCCATGACATGTGGGGATCATGG + Intergenic
1077426087 11:2478624-2478646 CCCATGACACGTGGGAATTATGG + Intronic
1077827324 11:5825396-5825418 CCCATGACATGTGGGAATTGTGG - Intronic
1078308805 11:10218366-10218388 CCCATGACACGTGGGAATTATGG + Intronic
1079600893 11:22312772-22312794 CCCATGACAGGTGGGAATTGTGG - Intergenic
1079826825 11:25206650-25206672 CCCATGACACATGGGAATTGTGG - Intergenic
1079835098 11:25323934-25323956 CCCATGACACGTGGGGATTATGG - Intergenic
1080208842 11:29761696-29761718 CCCATGACATGTGGGGATCTTGG + Intergenic
1080292137 11:30682930-30682952 CCCATGACACGTGGGAATTATGG - Intergenic
1080423297 11:32132513-32132535 CCCATGACACGTGGGAATTATGG - Intergenic
1080449617 11:32368168-32368190 CCCATGACACATGGGAATTGTGG + Intergenic
1080704524 11:34677929-34677951 CCCATGACACGTGGGAATTATGG - Intergenic
1080725729 11:34898342-34898364 CCAATGACCCGTGGGTATTGAGG - Intronic
1080873764 11:36259001-36259023 GCCAGGACACGTGTGTAGTGAGG + Intergenic
1080922841 11:36726069-36726091 CCCATGACACATGGGAATTGTGG + Intergenic
1081150198 11:39618918-39618940 CCCATGACATGTGGGAATTGTGG + Intergenic
1081279004 11:41185075-41185097 CCCATGACACATGGGAATTGTGG + Intronic
1081354275 11:42094109-42094131 CCCATGACACATGGGAATTGTGG - Intergenic
1081354534 11:42096047-42096069 CCCATGACACATGGGAATTGCGG - Intergenic
1081375147 11:42349718-42349740 CCCATGACACATGGGAATCATGG - Intergenic
1081455696 11:43220300-43220322 CCCATGACATGTGGGAATTGTGG + Intergenic
1082759696 11:57115411-57115433 CCCATGACACGTGCGGATTATGG - Intergenic
1082906521 11:58313024-58313046 CCCATGACACGTGGGAATTATGG + Intergenic
1083154287 11:60813163-60813185 CCCATGACACGTGAGGATTATGG + Intergenic
1083360531 11:62104343-62104365 CCCATGACATGTGGGGATTGTGG - Intergenic
1083493110 11:63027622-63027644 CCCATGACACGTGGGAATTATGG + Intergenic
1084300835 11:68250994-68251016 CCCATGACATGTGGGTATTATGG - Intergenic
1084320035 11:68368200-68368222 CCCACCACACGTGTGCCTCGGGG - Intronic
1085860377 11:80226200-80226222 CCCATGACACGTGGGGATTATGG + Intergenic
1085962794 11:81482383-81482405 CCCATGACACATGGGTATTATGG - Intergenic
1086187682 11:84038984-84039006 CCCATGACACGTGGGCATTATGG + Intronic
1086765697 11:90692848-90692870 CCCTTGACATGTGTGTATTATGG - Intergenic
1087730195 11:101769455-101769477 CCCATGACACTTGGGGATCATGG + Intronic
1087730959 11:101778395-101778417 CCCATGACACGTGGGAATTATGG - Intronic
1087917121 11:103823745-103823767 CCCTTGACACGTGAGGATCATGG - Intergenic
1088001158 11:104882708-104882730 CCCACGACACGTGGGAATTGTGG - Intergenic
1088421675 11:109655366-109655388 CCCATGACATGTGGGAATTGTGG + Intergenic
1088432596 11:109775263-109775285 CCCTTGACACGTGGGGATTGTGG + Intergenic
1090629707 11:128635468-128635490 CCCATGACACGTGGGGATTATGG + Intergenic
1090687438 11:129139516-129139538 CCCATGACATGTGGGAATTGTGG - Intronic
1091539819 12:1449394-1449416 CCCATGACACGTGGGGATGATGG - Intronic
1092452290 12:8614146-8614168 CCCATGACATGTGGGAATTGTGG + Intergenic
1093313090 12:17616596-17616618 CCCATGACACGTGGGGATTATGG + Intergenic
1093517889 12:20012585-20012607 CCCATGACACGTGTGGATTATGG - Intergenic
1093783116 12:23160043-23160065 CCCATGACACGTGGGGATTATGG - Intergenic
1094090574 12:26644725-26644747 CCCATGACACGTGGGAATTATGG + Intronic
1094595295 12:31859957-31859979 CCCATGACACGTGGGGATTATGG + Intergenic
1094622495 12:32093668-32093690 CCCATGACACGTGGGGATTATGG - Intergenic
1094716033 12:33016252-33016274 CCCATGACACATGGGAATTGTGG - Intergenic
1095112474 12:38313121-38313143 CCGTTGACACGTGGGGATCGTGG + Intergenic
1095294521 12:40513005-40513027 CCCATGACACATGTGAATTGTGG + Intronic
1095382938 12:41616376-41616398 CCCATGTCACGTGGGAATTGTGG - Intergenic
1095510585 12:42947525-42947547 CCCATGACACGTGGGAATTATGG + Intergenic
1095522708 12:43086044-43086066 CCCATGACATGTGGGGATCATGG - Intergenic
1095540506 12:43304028-43304050 CCCATGACATGTGGGGATCATGG + Intergenic
1095576325 12:43744280-43744302 CCCATGACATGTGGGAATTGTGG - Intronic
1095793198 12:46189662-46189684 CCCATGACACGTGGGAATTATGG - Intronic
1096245975 12:49986696-49986718 CCCATGACACGTGGGGATTATGG + Intronic
1097142094 12:56910252-56910274 CCCATGACACATGGGAATTGTGG - Intergenic
1097319710 12:58211507-58211529 CCCATGACACATGGGGATTGTGG + Intergenic
1097481144 12:60127056-60127078 CCCATGACACATGGGAATTGTGG - Intergenic
1097719825 12:63008539-63008561 CCCATGACACATGGGAATTGCGG - Intergenic
1097731314 12:63131482-63131504 CCCATGACACGTGGGAATTATGG + Intergenic
1098141316 12:67452774-67452796 CCCATGACACGTGGGAATTATGG + Intergenic
1098517146 12:71390433-71390455 CCCATGACACGTGGGAATTGTGG + Intronic
1098656365 12:73035088-73035110 CCCATGACACATGGGAATTGTGG + Intergenic
1098688389 12:73455236-73455258 CCCATGACACGTGGGGATTATGG - Intergenic
1098965128 12:76779561-76779583 CCCATGACACGTGGGAATTATGG + Intronic
1099039450 12:77632573-77632595 CCCACGACACGTGGGAATTGTGG + Intergenic
1099592845 12:84617919-84617941 CCCATGACACGTGGGGATTATGG - Intergenic
1099594042 12:84634823-84634845 CCCATGACACGTGGGAATCCTGG + Intergenic
1099694163 12:85997288-85997310 CCCTTGACACGTGGGAATTGTGG + Intronic
1099871783 12:88358850-88358872 CCCATGACACGTGGGGATTATGG - Intergenic
1100348482 12:93755202-93755224 CCCATGACATGTGGGTATTATGG + Intronic
1100787781 12:98096814-98096836 CCCATGACACATGGGAATTGTGG - Intergenic
1101147636 12:101856088-101856110 CCCATGACACGTGGGGATTATGG - Intergenic
1101337543 12:103809727-103809749 CCCATGACACGTGGGGATTATGG + Intronic
1101560250 12:105850563-105850585 CCCTTGACACGTGGGAATCATGG - Intergenic
1101724712 12:107379315-107379337 CCCATGACACGTGGGGATTATGG - Intronic
1101977204 12:109370089-109370111 CCCATGACACATGGGAATTGTGG + Intronic
1102037776 12:109782020-109782042 CCCATGACACGTGGGAATTGTGG - Intergenic
1102881790 12:116491073-116491095 CCCATGACACGTGGGGATTATGG + Intergenic
1103023384 12:117554527-117554549 CCCATGACATGTGGGAATTGTGG - Intronic
1103226162 12:119289966-119289988 CCCATGACACGTGGGGATTATGG + Intergenic
1103607255 12:122096549-122096571 CCCAGGACAGGTGTGTCTAGGGG + Intronic
1103830614 12:123776108-123776130 CCCATGACACGTGGGGATTATGG + Intronic
1104132334 12:125906254-125906276 CCCATGACACGTGGGAATTATGG + Intergenic
1104343382 12:127973206-127973228 CCCATGACACGTGGGGATTATGG - Intergenic
1104353523 12:128065670-128065692 CCCATGACATGTGGGAATTGTGG - Intergenic
1104416437 12:128599851-128599873 CCTATGACACGTGGGTATTATGG - Intronic
1104458853 12:128937657-128937679 CCCATGACACGTGGAGATCACGG - Intronic
1104590125 12:130077665-130077687 CCCATGACATGTGGGGATTGTGG + Intergenic
1104621301 12:130314825-130314847 CCCATGACACTTGGGAATTGTGG + Intergenic
1104665856 12:130646847-130646869 CCCATGGCGCCTGTGTGTCGTGG - Intronic
1105644437 13:22302506-22302528 CCCATGACACGTGGGGATTATGG + Intergenic
1105665262 13:22548684-22548706 CCCATCAGACGTGTGTATGTTGG + Intergenic
1106009240 13:25802022-25802044 CCCATGACACGTGAGGATTATGG + Intronic
1106352024 13:28940057-28940079 CCCATGACACGTGGGAATTACGG + Intronic
1106369967 13:29122556-29122578 CCCATGACATGTGGGAATTGTGG + Intronic
1106888464 13:34216277-34216299 CCCATGACACGTGGGAATTATGG + Intergenic
1107344110 13:39440774-39440796 CCCACGACACGTGGGAATTGTGG - Intronic
1107554330 13:41504267-41504289 CCCATGACACGTGGGGATTATGG + Intergenic
1107589224 13:41884208-41884230 CCCATGACACGTGGGGATTGTGG - Intronic
1107629622 13:42330055-42330077 CCCATGACACGTGGGGATTATGG + Intergenic
1108055487 13:46480863-46480885 CCCATGACACGTGGGAATTGTGG - Intergenic
1108142355 13:47437182-47437204 CCCATGACACATGGGAATTGTGG - Intergenic
1108185771 13:47887075-47887097 CCCATGACACGTGTGAATTATGG + Intergenic
1108438991 13:50429658-50429680 CCCATGACACGTGGGAATTATGG + Intronic
1108762128 13:53580670-53580692 CCCATGACACGTGGGGATTATGG + Intergenic
1108778480 13:53797044-53797066 CCCATGGCACGTGGGAATCGTGG + Intergenic
1108790532 13:53965170-53965192 CCCATGACATGTGGGAATTGTGG - Intergenic
1109391929 13:61705073-61705095 CCCATGACACGTGGGAATTATGG - Intergenic
1109634293 13:65092977-65092999 CTCATGACACGTGGGAATTGTGG + Intergenic
1109641825 13:65201725-65201747 CCCATGACACATGGGAATTGTGG - Intergenic
1109879178 13:68449611-68449633 CCCATGACACATGGGAATTGTGG - Intergenic
1109958997 13:69606006-69606028 CCCATGACACGTGGTTATTGTGG + Intergenic
1109971549 13:69777000-69777022 CCCATGACACGTGGGGATTATGG - Intronic
1110175056 13:72546222-72546244 CCCATGACACGTGGGGATTATGG + Intergenic
1110177024 13:72569105-72569127 CCCATGACACGTGGGAATTATGG - Intergenic
1110262838 13:73504925-73504947 CCCATGACACGTGGGGATTATGG + Intergenic
1110313025 13:74072925-74072947 CCCATGACATGTGGGGATCATGG - Intronic
1110432055 13:75436024-75436046 CCCATGACACGTGGGGATTATGG - Intronic
1110449429 13:75624809-75624831 CCCATGACACATGGGAATTGTGG + Intronic
1110521955 13:76490373-76490395 CCCATGACACGTGGGAATTGTGG - Intergenic
1110732562 13:78895938-78895960 CCCATGACACGTGGGAATTCTGG + Intergenic
1110960227 13:81612303-81612325 CCCATGACATGTGGGAATTGTGG + Intergenic
1111072412 13:83186682-83186704 CCCATGACACGTGGGAATTGTGG - Intergenic
1111072682 13:83188594-83188616 CCCATGACATGTGGGAATTGTGG - Intergenic
1111074433 13:83214965-83214987 CCCATGACACATGGGAATTGTGG + Intergenic
1111133853 13:84012912-84012934 CCCACAACATGTGTGAATCGTGG - Intergenic
1111189419 13:84789169-84789191 CCCTTGACACGTGAGAATTGTGG - Intergenic
1111378516 13:87413706-87413728 ACCATGACATGTGTATATCTAGG + Intergenic
1111403463 13:87770610-87770632 CCCATGACACGTGGGAATTATGG + Intergenic
1111527493 13:89491708-89491730 CCCATGACACATGGGAATTGAGG + Intergenic
1111709455 13:91793341-91793363 CCCATGACACGTGGGGATTATGG + Intronic
1111711650 13:91822672-91822694 CCCATGACACGTGGGGATTATGG + Intronic
1111819424 13:93194836-93194858 CCCATGACACATGGGAATTGTGG - Intergenic
1112119250 13:96391821-96391843 TCCATGACACGTGGGAATTGTGG + Intronic
1112268743 13:97949418-97949440 CCCATGACACATGGGAATTGTGG - Intergenic
1112887966 13:104196887-104196909 CCCATGACACGTGGGGATTATGG + Intergenic
1112946899 13:104939697-104939719 CCCATGACACGTGGGGATTATGG - Intergenic
1113176759 13:107573664-107573686 CCCATGACATGTGGGAATCGTGG - Intronic
1113329718 13:109316553-109316575 CCCATGACATGTGGGGATTGTGG + Intergenic
1113354608 13:109566567-109566589 CCCGTGACACGTGGGGATTGTGG - Intergenic
1113526180 13:110979479-110979501 CCCATGACACGTGGGGATTATGG + Intergenic
1114661442 14:24347830-24347852 CCCATGACACGTGGGAATTGTGG + Intergenic
1114989642 14:28271569-28271591 CCCATGACATGTGGGGATTGTGG + Intergenic
1115009204 14:28523321-28523343 CCCATGATACATGGGTATCATGG - Intergenic
1115015192 14:28602472-28602494 CCCATGACACGTGGGAATTATGG + Intergenic
1115143347 14:30199057-30199079 CCCATGACACGTGGGGATTATGG + Intergenic
1115298343 14:31856340-31856362 CCCATGACACATGGGAATTGTGG + Intronic
1115318684 14:32054570-32054592 CCCATGACACATGGGAATTGTGG - Intergenic
1115929877 14:38478830-38478852 CCCATGACATGTGGGAATTGTGG - Intergenic
1115942007 14:38620211-38620233 CCCATAACACGAGAGAATCGTGG + Intergenic
1116020760 14:39457504-39457526 CCCATGACATGTGGGGATTGTGG + Intergenic
1116676676 14:47914955-47914977 CCCATGACACGTGGGAATTGTGG - Intergenic
1116784310 14:49270297-49270319 CCCATGACACGTGGGGATTATGG - Intergenic
1117639101 14:57778000-57778022 CCCATGACATGTGGGAATTGTGG - Intronic
1118151562 14:63195688-63195710 CCCATGACACGTGGGGATTATGG - Intergenic
1118226085 14:63900560-63900582 CCCATGACACGTGGGAATTGTGG + Intronic
1118239736 14:64044612-64044634 CCCATGACACATGGGAATTGTGG - Intronic
1118661282 14:68015677-68015699 CCCATGACACGTGGGGATTATGG + Intronic
1119040240 14:71268262-71268284 CCCATGACACGTGGGGATTATGG - Intergenic
1119047961 14:71337640-71337662 CCCATGACACGTGGGAATTATGG + Intronic
1120136257 14:80873722-80873744 CCCATGACACGTGGGAATTGTGG - Intronic
1120285774 14:82499246-82499268 CCCATGACACGTGGGGATTATGG - Intergenic
1120514181 14:85450717-85450739 ACCATGGCACGTGTGTACCTAGG + Intergenic
1120534181 14:85672298-85672320 CCCATGACATGTGGGAATTGTGG + Intergenic
1120549876 14:85857679-85857701 CCCATGACACATGGGAATTGTGG - Intergenic
1120705273 14:87739285-87739307 CCCATGACAGGTGAGAATTGTGG - Intergenic
1120720525 14:87885456-87885478 CCCATGACACGTGGGGATTATGG + Intronic
1120837688 14:89056208-89056230 CCCATGACACATGGGAATTGTGG + Intergenic
1120956592 14:90088750-90088772 CCCATGACACGTGGGAATTGTGG - Intronic
1121288841 14:92757998-92758020 CCCATGACACGTGGGGATTATGG - Intergenic
1121515542 14:94547526-94547548 CCCATGACACGTGTGGATTATGG - Intergenic
1121825072 14:97003423-97003445 CCCATGACATGTGGGAATTGTGG - Intergenic
1121846841 14:97179641-97179663 CCCATGACACATGTGGATTATGG - Intergenic
1121989216 14:98538987-98539009 CCCATGACACATGGGGATTGTGG - Intergenic
1122026414 14:98880708-98880730 CCCATGACACATGGGAATTGTGG - Intergenic
1123195812 14:106615593-106615615 CCCACGACACGTGGGAATTGTGG + Intergenic
1124066152 15:26345987-26346009 CCCATGACACATGGGAATTGTGG - Intergenic
1124066402 15:26347857-26347879 CCCATGACACATGGGAATTGTGG - Intergenic
1124847230 15:33303027-33303049 CCCATGACACGTGGGGATTGTGG - Intergenic
1125049983 15:35285311-35285333 CCCACGACACGTGGGAATTGTGG - Intronic
1126489340 15:49219189-49219211 CCCAGGACACGTGGGAATTGTGG - Intronic
1126539201 15:49803640-49803662 CCCATGACATGTGGGAATTGTGG + Intergenic
1128470856 15:67951310-67951332 CCCATGAGACGTGGGAATTGTGG - Intergenic
1128710460 15:69867590-69867612 CCCATGACACGTGGGAATTGTGG - Intergenic
1129459339 15:75692622-75692644 CCCATGACCCCTGTGCATCCCGG - Intronic
1130324293 15:82866605-82866627 CCCATGACATGTGGGAATTGTGG - Intronic
1130376630 15:83335007-83335029 CCCATGACACGTGAGAATTATGG - Intergenic
1131015121 15:89051569-89051591 CCCATGACATGTGGGAATTGTGG - Intergenic
1131724364 15:95205857-95205879 CCCATGACACATGGGAATTGTGG - Intergenic
1131970009 15:97882328-97882350 CCCATGACAGGTGGGAATTGTGG - Intergenic
1132141594 15:99401449-99401471 CCCATGACATGTGGGAATTGTGG + Intergenic
1133089811 16:3395352-3395374 CCCATGACACGTGGGGATTATGG - Intronic
1133243953 16:4434206-4434228 CCCATGACACGTGGGGATTATGG + Intronic
1133544886 16:6796290-6796312 CCCATGACACTTGGGAATTGTGG + Intronic
1133601867 16:7347489-7347511 GTCATGACACGTGGGAATCGTGG + Intronic
1133675926 16:8071719-8071741 CCCATGACACGTGGGGATTATGG + Intergenic
1133835347 16:9362726-9362748 CCCATGACACGTGGGAATTGTGG + Intergenic
1134212739 16:12291458-12291480 CCCACGACACGTGGGAATTGTGG + Intronic
1134820401 16:17242122-17242144 CCCATGACACATGGGAATTGTGG + Intronic
1135680196 16:24449929-24449951 CCCATGACACGTGGGGATTATGG + Intergenic
1135915778 16:26604300-26604322 CCCATGACACGTGGGAATTGTGG - Intergenic
1136085509 16:27882061-27882083 CCCATGACACGTGGGAATTATGG - Intronic
1138297720 16:55901064-55901086 CCCATGACACGTGGGAATTATGG - Intronic
1138895308 16:61197606-61197628 CCCATGACATGTGGGAATTGTGG - Intergenic
1138895621 16:61200337-61200359 CCCATGACATGTGGGAATTGGGG - Intergenic
1139104924 16:63817251-63817273 CCTATGACACGTGGGAATTGTGG - Intergenic
1139238729 16:65368531-65368553 CCCATGACACATGTGAATTATGG - Intergenic
1139797737 16:69496976-69496998 CCCATGACAGGTGGGAATTGTGG - Intergenic
1140019995 16:71229877-71229899 CCCATGACACGTGGGGATTATGG - Intronic
1140998154 16:80281075-80281097 CCCATGACACGTGGGAATTATGG + Intergenic
1143335775 17:6170522-6170544 CCCATGACACGTGGGAGTTGTGG + Intergenic
1144172941 17:12677347-12677369 CCCATGACACGCGTTTACCTGGG + Intronic
1146098485 17:29955289-29955311 CCCATGACACGTGGGAATTATGG - Intronic
1146544160 17:33724006-33724028 CCCATGACACATGGGAATTGTGG - Intronic
1146571572 17:33957660-33957682 CCCATGACACGTGGGGATTATGG + Intronic
1147477313 17:40724499-40724521 CCCATGACACGTGGGGATTATGG - Intergenic
1147532808 17:41295711-41295733 CCCATGACACATGGGAATTGTGG + Intergenic
1147834204 17:43318368-43318390 CCCATGACACGTGGGAATTATGG + Intergenic
1147871065 17:43588021-43588043 CCCATGACACGTGGGAATGGTGG + Intergenic
1148199927 17:45743414-45743436 CCCATGACACGTGGGAATTGTGG + Intergenic
1149069805 17:52526490-52526512 CCCATGACACGTGGGGATCATGG - Intergenic
1149112937 17:53055893-53055915 CCCATGACACGTAGGAATTGTGG - Intergenic
1149113277 17:53061304-53061326 CCCATGACACGTGGGAATTATGG - Intergenic
1149308436 17:55371587-55371609 CCCATGACACGTGGGGATTATGG - Intergenic
1149340980 17:55686259-55686281 CCCATGACATGTGGGAATTGTGG - Intergenic
1150146261 17:62772149-62772171 CCCATGACACATGGGAATTGTGG - Intronic
1150203184 17:63378023-63378045 CCCATGACACGTGGGGATTATGG + Intronic
1150557155 17:66264702-66264724 CCCATGACACGTGGGGATTATGG - Intergenic
1150987527 17:70214663-70214685 CCCATGACACGTGGGGATTATGG - Intergenic
1150988919 17:70232340-70232362 CCCATGACACGTGGGAATTGTGG + Intergenic
1151018069 17:70580100-70580122 CCCATGACACGTGGAAATTGTGG - Intergenic
1151086025 17:71381703-71381725 CCCATGACTTGTGTGTTTAGGGG - Intergenic
1151222838 17:72625955-72625977 CCCATGACACGTGGGGATTATGG + Intergenic
1151411221 17:73931223-73931245 CCCATGACACGTGGGGATTATGG - Intergenic
1151726178 17:75885982-75886004 CCCACGACACGTGGGGATCATGG - Intronic
1151873574 17:76853059-76853081 CCCACGACACGTGGGAATTGTGG + Intergenic
1152915766 17:83034627-83034649 CCCACGACACGTGGGAATTGTGG - Intronic
1153096998 18:1418431-1418453 CCCATGACATGTGAGAATTGTGG - Intergenic
1153142623 18:1991982-1992004 CCCATGACACGTGGGGATTATGG - Intergenic
1153161913 18:2216189-2216211 CCCATGACACGTGGGGATTATGG - Intergenic
1153537970 18:6123361-6123383 CCCATGATACGTGGGGATTGTGG - Intronic
1153929508 18:9866292-9866314 CCCATGACACATGGGAATTGTGG + Intergenic
1154986071 18:21552308-21552330 CCCATGACACGTGGGGATTATGG - Intronic
1155080865 18:22408474-22408496 CCCATGACACGTGAGGATTATGG - Intergenic
1155515843 18:26623383-26623405 CCCATGACACGTGTGTATCGTGG - Intronic
1155818524 18:30346908-30346930 CCCATGACATGTGGGAATTGTGG + Intergenic
1156022960 18:32620623-32620645 CCCATGACACGTGGGGATTATGG - Intergenic
1156673461 18:39498930-39498952 CCCATGACATGTGGGAATCGTGG + Intergenic
1156862899 18:41858974-41858996 CCCATGACACGTGAGGATTATGG + Intergenic
1157549134 18:48568898-48568920 CCCATGACAAGTGGGGATTGTGG + Intronic
1157966336 18:52212399-52212421 CCCATGACACATGGGAATTGTGG - Intergenic
1158220315 18:55143848-55143870 CCCATGACACGTGGGGATTACGG - Intergenic
1158566681 18:58560099-58560121 CCCATGACATGTGGGAATTGTGG - Intronic
1158639183 18:59188793-59188815 CCCATGACACGTGGGAATTACGG + Intergenic
1158684556 18:59601277-59601299 CCCATGACACGTGGGGATTATGG - Intronic
1158941739 18:62411224-62411246 CCCATGACACGTGGGAATTATGG - Intergenic
1159032586 18:63246600-63246622 CCCATGACATGTGGGAATTGTGG + Intronic
1159507872 18:69359653-69359675 CCCATGACATGTGGGAATTGTGG - Intergenic
1159512134 18:69409015-69409037 CCCATGACACGTGGGGATTATGG - Intronic
1159888320 18:73931705-73931727 CCCATGACACGTGGGGATTATGG - Intergenic
1160268250 18:77359621-77359643 CCCATGACACGTGGGGATTATGG - Intergenic
1160956557 19:1695541-1695563 CCCACGACACGTGGGAATTGTGG - Intergenic
1162894000 19:13753861-13753883 CCCATGACACGTGGGGATTATGG + Intronic
1164838928 19:31377842-31377864 CCCATGACACATGGGAATTGTGG - Intergenic
1166638012 19:44469066-44469088 CCCATGACACATGGGAATTGTGG + Intergenic
1168587226 19:57603285-57603307 CCCATGACACATGGGAATTGTGG + Intronic
925087608 2:1121796-1121818 CCCTTGACACGTGGGGATCAGGG + Intronic
925096820 2:1211766-1211788 CCCATGACACGTGGGAATTATGG + Intronic
925457512 2:4028566-4028588 CCCATGACACGTGGGAATTGTGG - Intergenic
925646358 2:6041267-6041289 CCCATGACACGTGGGAATTATGG - Intergenic
925846317 2:8037216-8037238 CCCATGACACATGGGAATTGTGG + Intergenic
926335592 2:11860296-11860318 TCCATGACACGTGAGAATTGTGG + Intergenic
926709998 2:15871714-15871736 CCCATGACACGTGGGGATTAAGG - Intergenic
926744096 2:16136329-16136351 CCCATGACACATGGGAATTGTGG - Intergenic
926984794 2:18611062-18611084 CCCATGGCCCCTGTGTCTCGAGG + Intergenic
927237204 2:20885192-20885214 CCCATGACACGTGGGGATTATGG - Intergenic
927356395 2:22178127-22178149 CCCATGACACGTGGGTATTATGG + Intergenic
927360318 2:22224656-22224678 CCCATGACATGTGGGAATTGTGG - Intergenic
927386519 2:22540392-22540414 CCCATGACACTTGGGAATTGTGG + Intergenic
927396310 2:22655290-22655312 CCCATGACACATGGGAATCATGG - Intergenic
928178039 2:29048261-29048283 CCCATGACACGTAGGAATTGTGG + Intronic
928324157 2:30306722-30306744 CCCATGACATGTGGGTATTATGG - Intronic
928460530 2:31468192-31468214 CCCATTACACGTGGGAATTGGGG - Intergenic
928463980 2:31502760-31502782 CCCATGACACGGGGGAATTGTGG + Intergenic
928735171 2:34280044-34280066 CCCACAACACGTGGGTATTGTGG + Intergenic
929029289 2:37635869-37635891 CCCATGACACGTGGGGATTACGG + Intergenic
929275688 2:40022156-40022178 CCCATGACACATGGGAATTGTGG - Intergenic
929357962 2:41049645-41049667 CCCATGACACATGGGAATTGTGG - Intergenic
929372025 2:41236883-41236905 CCCATGACACATGGGGATTGTGG + Intergenic
930269813 2:49242570-49242592 CCCATGACACATGTGGATTATGG + Intergenic
930438585 2:51377932-51377954 CCCATGACACATGGGGATCATGG - Intergenic
930443541 2:51440932-51440954 CCCTTGCCACGTGTGTATAGTGG - Intergenic
930503045 2:52247323-52247345 CCCATGACACGTGGGGATTATGG - Intergenic
930558369 2:52929076-52929098 CCCATGACACATGGGAATTGTGG + Intergenic
930833063 2:55765886-55765908 CCCATGACATGTGGGAATTGTGG + Intergenic
933031338 2:77332913-77332935 CCCATGACACGTGGGAATTGTGG - Intronic
933071199 2:77860081-77860103 CTCATGACACGTGGGAATTGTGG - Intergenic
933419953 2:82032102-82032124 CCCATGACACATGTGAATTGTGG + Intergenic
933943792 2:87267061-87267083 CCCATGACACATGGGGATCTTGG - Intergenic
934050176 2:88203578-88203600 CCCATGACACGTGGGAATTGTGG - Intergenic
934113137 2:88760508-88760530 CCCATGACATGTGAGAATTGTGG - Intergenic
935228463 2:101075483-101075505 CCCTTGACACGTGGGAATTGTGG - Intronic
936169231 2:110154069-110154091 CCCATGACATGTGAGAATTGTGG - Intronic
936336428 2:111594518-111594540 CCCATGACACATGGGGATCTTGG + Intergenic
936405266 2:112197049-112197071 CCCATGACACATGGGAATTGTGG + Intergenic
936897446 2:117444733-117444755 CCCATGACACTTGGGAATTGTGG - Intergenic
936909591 2:117576335-117576357 CCCATGACACGTGGGGATTATGG + Intergenic
937496468 2:122425728-122425750 CCCATGACATGTGGGAATTGTGG + Intergenic
937800470 2:126075855-126075877 CCCATGACACGTGGGAATTATGG - Intergenic
938010662 2:127826394-127826416 CCTATGACACGTGGGAATTGTGG - Intergenic
938544381 2:132314579-132314601 CCCATGACACATGGGAATTGTGG + Intergenic
939236653 2:139502869-139502891 CCCATGGCATGTGTTTATCTAGG + Intergenic
939471640 2:142629720-142629742 CCCATGACACATGAGTATTATGG + Intergenic
939514017 2:143143811-143143833 CCCATGACACAAGTTTATCTAGG - Intronic
940135776 2:150434748-150434770 CCCATGACACGTGGTAATTGTGG - Intergenic
940415892 2:153419327-153419349 CCCATGACACGTGGGGATTATGG + Intergenic
940450199 2:153827288-153827310 CCCATGACACATGGGAATTGTGG + Intergenic
940575542 2:155499332-155499354 CCCATGACACATGCGTATTATGG - Intergenic
940632968 2:156261757-156261779 CCCATGACACAAGTTTATCTAGG + Intergenic
941137577 2:161736691-161736713 CCCATGACACATGGGGATCATGG + Intronic
941490734 2:166139329-166139351 CCCATGACACATGGGAATGGTGG - Intergenic
942123868 2:172804021-172804043 CCCATGACATGTGGGAATTGTGG + Intronic
942319478 2:174724129-174724151 CCCATGACATGTGGGAATTGTGG + Intergenic
942859804 2:180596026-180596048 CCCATGACACGTGGGGATTATGG - Intergenic
943257432 2:185613564-185613586 CCCATGACATGTGGGAATTGTGG + Intergenic
943393858 2:187307124-187307146 CCCATGACACGTGGGGATTATGG - Intergenic
943483819 2:188455373-188455395 CCCATGACACATGGGAATTGTGG - Intronic
943704050 2:191016209-191016231 CCCATGACAGGTGGGAATTGTGG + Intronic
944108764 2:196108375-196108397 CCCATGACACGTGGGGATTATGG + Intergenic
944686175 2:202119866-202119888 CCCATGACATGTGGGAATTGTGG - Intronic
945031550 2:205669045-205669067 CCCATGACACGTGGGGATTATGG + Intergenic
945635343 2:212342275-212342297 CCCATGACACGTGGGGATTATGG - Intronic
946472419 2:219974497-219974519 CCCATGACACGTGGGGATTATGG + Intergenic
946808422 2:223496458-223496480 CCCTTGACACGTGGGGATTGCGG - Intergenic
946882787 2:224193138-224193160 CCCATGACACATGAGAATTGTGG - Intergenic
946988472 2:225301630-225301652 CCCATGACACGCGGGAATTGTGG - Intergenic
947048628 2:226017849-226017871 CCCATGACACGTGAGGATTATGG + Intergenic
947177463 2:227382345-227382367 CCCACGACACGTGAGGATCATGG - Intergenic
947349311 2:229225911-229225933 CCCAGAACACGTGGGGATCGTGG + Intronic
947603193 2:231467358-231467380 CCCATGAAACCTGTGTAGTGAGG + Intronic
947825036 2:233100064-233100086 CCCACGACACGTGGGAATTGTGG + Intronic
947955502 2:234186981-234187003 CCCATGACATGTGGGAATTGTGG - Intergenic
948785895 2:240352794-240352816 CCCATGACACGTGGGAATTAAGG + Intergenic
948851378 2:240708745-240708767 CCCATGACACATGGGAATCATGG + Intergenic
1169752680 20:9010754-9010776 CCCATGACACGTGGGAATTGTGG - Intergenic
1170184661 20:13575343-13575365 CCCATGACACATGGGTATTATGG - Intronic
1170491374 20:16878711-16878733 CCCATGACACATGGGAATTGTGG + Intergenic
1171873247 20:30547313-30547335 CCCATGACACATGGGAATTGTGG + Intergenic
1172725702 20:37039401-37039423 CCCATGACACGTGGGAATTATGG - Intronic
1172997077 20:39078736-39078758 CCCTTGACACGTGAGGATTGTGG - Intergenic
1173392741 20:42649358-42649380 CCCATGACACGTGGGAATTGTGG + Intronic
1173740676 20:45399551-45399573 CCCATGACACGTGGGGATTATGG - Intronic
1173860478 20:46280027-46280049 CCCATGACACGTATGTGACCTGG - Intronic
1173960206 20:47065165-47065187 CCCATGACACGTGGGAATTATGG + Intronic
1174686249 20:52458372-52458394 CCCATGACACGTGGGGATTATGG - Intergenic
1174856871 20:54054189-54054211 CCCATGACACGTGGGGATTATGG + Intronic
1175183361 20:57163939-57163961 CCCACGACACGTGGGAATTGTGG - Intergenic
1175192643 20:57221958-57221980 CCCATGACACTTGTCTATGCTGG - Intronic
1175373262 20:58507048-58507070 CCCATGACACCTGGGAATTGTGG - Intronic
1175693929 20:61086986-61087008 CCCATGACACGTGGGAATTATGG + Intergenic
1175990724 20:62787335-62787357 CCCATGACACGTGAGGATTATGG - Intergenic
1176587610 21:8604034-8604056 CCCATGACATGTGTGGATTATGG - Intergenic
1176977831 21:15343598-15343620 CCCATGCCACAAGTGTATCATGG + Intergenic
1177358208 21:20036466-20036488 CTCATGACACGTGAGAATTGTGG - Intergenic
1177392523 21:20494903-20494925 CTCATGACACGTGGGTATTATGG + Intergenic
1177478013 21:21649948-21649970 CCCATGACACATGAGAATTGTGG - Intergenic
1177619316 21:23566658-23566680 CCCATGACATGTGGGGATCATGG - Intergenic
1177755466 21:25342093-25342115 CCCATGACACGTGGGAATTGTGG - Intergenic
1177854063 21:26382353-26382375 CCCATGACACGTGGGGATTATGG - Intergenic
1178079906 21:29052555-29052577 CCCATGACATGTGGGAATTGTGG + Intronic
1178110347 21:29363787-29363809 CCCATGACACGTGGGGATTATGG - Intronic
1178222065 21:30671226-30671248 CCCATGACACCTGGGAATTGTGG + Intergenic
1178280688 21:31280215-31280237 CCCATGACACGTGGGAATGTGGG - Intronic
1178326134 21:31646927-31646949 CCCATGATACGTGGGAATTGTGG - Intergenic
1178376494 21:32071818-32071840 CCCATGACACGTGGGAATTATGG + Intergenic
1178429312 21:32505102-32505124 CCCATGACACATGTGGATTATGG + Intronic
1178483160 21:32997698-32997720 CCCATGACAGGTGGGAATTGTGG - Intergenic
1178774150 21:35533221-35533243 CCCATGACACGTGGGGATTATGG - Intronic
1178800038 21:35785685-35785707 CCCACGACACGTGGGGATCATGG - Intronic
1179007155 21:37525480-37525502 CCCATGACACGTGGGGATTATGG + Intergenic
1179339421 21:40490218-40490240 CCCATGACACGTGGGAATTATGG + Intronic
1179350623 21:40607553-40607575 CCCATGACACGTGGGAATTATGG - Intronic
1180218240 21:46340280-46340302 CCCATGACACGTGGGAATTGTGG + Intronic
1180270440 22:10581032-10581054 CCCATGACATGTGTGGATTATGG - Intergenic
1182608456 22:31526484-31526506 CCCATGACACGTGGGGATTATGG + Intronic
1182650516 22:31847677-31847699 CCCATGACACGTGGGGATTATGG + Intronic
1182709941 22:32314945-32314967 CCCATGACACATGGGAATTGTGG + Intergenic
1182788667 22:32930186-32930208 CCCATGACACATGGGAATTGTGG - Intronic
1182811652 22:33121989-33122011 CCCATGACACGTGGGAATTATGG + Intergenic
1182992950 22:34785357-34785379 CCCATGACACATGGGAATTGTGG - Intergenic
1184540393 22:45119635-45119657 CCCACGACACGTGGGAATTGTGG + Intergenic
1184854889 22:47141248-47141270 CCCATGACATGTGGGGATTGTGG + Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
949139742 3:617717-617739 CCCATGACATGTGTGGATTATGG + Intergenic
949354652 3:3166152-3166174 CCCATGACATGTGGGAATTGTGG - Intronic
949555977 3:5153261-5153283 CCCATGACACATGGGAATTGTGG - Intronic
949770503 3:7572060-7572082 CCCATGACACATGGGAATTGTGG + Intronic
949854635 3:8450164-8450186 CCCATGACACGTGGGAATTATGG + Intergenic
950371082 3:12531177-12531199 TCCATGACACGTGGGGATTGTGG + Intronic
950589168 3:13923653-13923675 CCCATGACACGTGGGGATTATGG - Intergenic
950843405 3:15989316-15989338 CCCATGACACATGGGAATTGTGG + Intergenic
951467923 3:23021731-23021753 CCCATGACACGTGGGAGTTGAGG + Intergenic
951849338 3:27121419-27121441 CCCATGACACATGGGAATTGTGG - Intronic
952188294 3:30994151-30994173 CCCATGACACATGGGTATTATGG + Intergenic
952255240 3:31689580-31689602 CCCACGACACGTGGGAATTGTGG - Intronic
952401068 3:32964818-32964840 CCCATGACACGTGGGGATTGTGG - Intergenic
952628251 3:35433692-35433714 CCCATGACACGTGGGAATTGTGG - Intergenic
952891657 3:38046316-38046338 CCCATGACACGTGGGGATTACGG - Intronic
953409142 3:42679463-42679485 CCCACGACACGTGGGAATCGTGG + Intergenic
955617494 3:60824642-60824664 CCCATGACACATGGGAATTGTGG - Intronic
955808127 3:62757988-62758010 CCCATGACACGTGGGAATTATGG + Intronic
956203418 3:66731178-66731200 CCCATAACACGTGGGAATTGTGG - Intergenic
956389684 3:68758334-68758356 CCCATGACACGTGGGAATCGTGG - Intronic
956737954 3:72252975-72252997 CCCATGACACATGGGGATTGTGG + Intergenic
956974663 3:74565858-74565880 CCCATGACATGTGGGAATTGTGG - Intergenic
957160165 3:76600677-76600699 CCCACGACACGTGGGAATTGTGG + Intronic
957221666 3:77390371-77390393 CCCATGACACGTGGGAATTGTGG - Intronic
957765624 3:84621058-84621080 CCCATGACACGTGGGAATTATGG + Intergenic
957781231 3:84820381-84820403 CCCATGACACATGGGAATTGTGG + Intergenic
958040167 3:88218096-88218118 CCCATGACACGTGAGGATTATGG - Intergenic
958519243 3:95162379-95162401 CCCATGACACATGGGGATTGTGG - Intergenic
959182003 3:102993103-102993125 CCCATGACACGTGGGGATTATGG + Intergenic
959482641 3:106892154-106892176 CCCATGACACGTGAAAATTGTGG - Intergenic
960067019 3:113384968-113384990 CCCATGACATGTGGGAATTGTGG - Intronic
960139500 3:114138572-114138594 CCCATGACACATGGGAATTGTGG + Intronic
960689036 3:120324021-120324043 CCCATGACACGTGGGGATTATGG + Intergenic
960695607 3:120393468-120393490 CCCATGGAATGTGTGTATCAAGG + Exonic
961619272 3:128210721-128210743 GTCATGACACGTGTGAATCAAGG - Intronic
961806533 3:129493298-129493320 CCCATGACAGGTGTTTATTATGG - Intronic
963494383 3:146041942-146041964 CCCATGACACATGGGAATTGTGG + Intergenic
964005946 3:151829114-151829136 CCCATGACACATGGGAATTGTGG - Intergenic
964187930 3:153968527-153968549 CCCATGACACGTGGGAATTGTGG + Intergenic
964258466 3:154806167-154806189 CCCATGACACGTGGGAATTGTGG + Intergenic
964279758 3:155051675-155051697 CCCATGACACATGGGTATTATGG + Intronic
964466502 3:156998925-156998947 CCCATGACACGTGGGGATTATGG - Intronic
964975423 3:162614195-162614217 CCCATGACACGTGGGGATTATGG - Intergenic
965076058 3:163977865-163977887 CCCATGACACATGGGAATTGTGG + Intergenic
965506271 3:169518719-169518741 CCCATGACACATGGGAATTGTGG - Intronic
965964789 3:174474068-174474090 CCCATGACACGTGGGGATTATGG + Intronic
966576567 3:181509729-181509751 CCCATGACATGTGGGAATTGTGG - Intergenic
967453463 3:189652705-189652727 CCCATGACACGTGGGGATTATGG - Intronic
967513542 3:190340553-190340575 CCCACAACACGTGGGAATCGTGG + Intronic
967546265 3:190732426-190732448 CCCATGACACATGGGAATTGTGG - Intergenic
967582871 3:191179992-191180014 CTCATGACATGTGTGTATTATGG - Intergenic
967614260 3:191546573-191546595 CCCATGACATGTGGGAATTGTGG + Intergenic
969441490 4:7219719-7219741 CCCATGACACGTGGGGATCGTGG + Intronic
969843477 4:9900921-9900943 CCCATGACACATGGGGATTGTGG + Intronic
970094385 4:12445841-12445863 CCCATGACACGTGAGGATTATGG + Intergenic
970165395 4:13231878-13231900 CCCATGACACGTGGGCATTAGGG + Intergenic
970301929 4:14690983-14691005 CCCATGACATGTGGGGATCATGG - Intergenic
970344172 4:15137115-15137137 CCCATGACACATGGGAATTGTGG + Intergenic
970553327 4:17206398-17206420 CCCATGACACGTGGGGATTATGG + Intergenic
970562462 4:17296059-17296081 CCCATGACACATGTGGATTATGG + Intergenic
970577601 4:17443418-17443440 CCCTTGACACGTGGGTATAATGG + Intergenic
970635671 4:18006772-18006794 CCCATGACAGGTGGGAATTGTGG + Intronic
970892125 4:21058914-21058936 CCCATGACACGTGAGAATTATGG - Intronic
970956168 4:21814322-21814344 CCCATGACATGTGGGAATTGTGG - Intronic
971042600 4:22770958-22770980 CCCATGACATGTGGGAATTGTGG - Intergenic
971056829 4:22922675-22922697 CCCATGACAGGTGGGTATTACGG - Intergenic
971155331 4:24075570-24075592 CCCATGACACGTGGGAATTATGG - Intergenic
971499124 4:27299885-27299907 CCCATGACACGTATGGATTATGG + Intergenic
971510296 4:27416025-27416047 CCCATGACACTTGGGAATTGTGG - Intergenic
971538130 4:27780355-27780377 CCCATGACACATGGGAATTGTGG - Intergenic
971631588 4:28999412-28999434 CCTATGACACGTGGGAATTGTGG - Intergenic
971843711 4:31891618-31891640 CCCATGACATGTGGGAATTGTGG - Intergenic
972227998 4:37036415-37036437 CCCATGACATGTGGGAATTGTGG + Intergenic
972718111 4:41668987-41669009 CCCATGACATGTGGGAATCATGG + Intronic
972841202 4:42932078-42932100 CCCATGACATGTGGGAATTGTGG + Intronic
972993457 4:44851100-44851122 CCCATGACACATGGGAATTGTGG - Intergenic
973007848 4:45035067-45035089 CCCATAACACGTGGGAATTGTGG - Intergenic
973212875 4:47636517-47636539 CCCATGACATGTGGGAATTGTGG - Intronic
973582357 4:52356915-52356937 CCCATGACACGTGGGAATTATGG + Intergenic
974154739 4:58056300-58056322 CCCATGACATGTGGGAATCATGG + Intergenic
974210998 4:58776249-58776271 CCCATGACATGTGGGGATCATGG + Intergenic
974265098 4:59577070-59577092 CCCATGACATGTGGGGATTGTGG - Intergenic
974269502 4:59632657-59632679 CCCATGACACATGGGAATGGTGG + Intergenic
974497438 4:62650584-62650606 CCCATGACACGTGGGGATTATGG + Intergenic
974517583 4:62936982-62937004 CCCATGACATGTGGGAATTGTGG - Intergenic
974588398 4:63912160-63912182 CCCTTGACACGTGGGTATAATGG - Intergenic
974628637 4:64455046-64455068 CCCATGACACATGGGGATCATGG + Intergenic
974690071 4:65287183-65287205 CCCATGACACGTGGGGATTATGG + Intergenic
974811864 4:66956084-66956106 CCCATGACATGTGTGGATGATGG + Intergenic
974876282 4:67707014-67707036 CCCATGACAAGTGGGAATTGTGG + Intergenic
974902186 4:68014335-68014357 CCCATGACACGTGGGAATTGTGG - Intergenic
975200389 4:71581453-71581475 CCCATGACACGTGGGAATTGTGG + Intergenic
975382759 4:73721193-73721215 CCCATGACACGTGGGAATTATGG + Intergenic
975899063 4:79128760-79128782 CCCATGACACGTGTGGATTATGG - Intergenic
975925167 4:79442275-79442297 CCCATGACACGTGGGGATTATGG - Intergenic
976144856 4:82032462-82032484 CCCACGACACGTGGGAATCATGG + Intronic
976259762 4:83134737-83134759 CCCATGACATGTGGGGATTGTGG + Intronic
976363958 4:84212681-84212703 CCCATGACACGTGGGAATTATGG - Intergenic
976472046 4:85440214-85440236 CCCATGACACGTGGAAATTGTGG + Intergenic
976674960 4:87693232-87693254 CCCATGACACATGGGAATTGTGG - Intergenic
976804124 4:89026746-89026768 CCCTTGACACGTGGGGATTGGGG + Intronic
977127884 4:93193334-93193356 CCCATGACACGTGGGGATTATGG - Intronic
977545270 4:98369195-98369217 CCCATGACACGTGGGGATTGTGG + Intronic
978049527 4:104180207-104180229 CCCATGACACGTGGGGATTATGG + Intergenic
978106875 4:104913217-104913239 CCCATGACATGTGGGCATTGTGG + Intergenic
978181049 4:105796337-105796359 CCCATGACATGTGGGAATTGTGG + Intronic
978181381 4:105800363-105800385 CCCAGGACACGTGGGAATTGTGG + Intronic
978188749 4:105888946-105888968 CCCATGACATGTGGGAATTGTGG + Intronic
978365276 4:107974831-107974853 CCCATGACACGTGGGGATTATGG - Intergenic
978832867 4:113110330-113110352 CCCATGACACGTGGGGATTATGG + Intronic
978917490 4:114144741-114144763 CCCATGACACGTGGGGATTATGG - Intergenic
979006831 4:115309514-115309536 CCCATGACACGTGGGCATTAGGG - Intergenic
979128133 4:117002795-117002817 CCCATGACACGTGGGAATTATGG + Intergenic
979511322 4:121557165-121557187 CCCATGACACGTGGGGATTATGG - Intergenic
979699899 4:123655947-123655969 CCCATGACACGTGGGGATTATGG + Intergenic
980551546 4:134342827-134342849 CCCATGACACGTGGGGATTATGG + Intergenic
980556074 4:134407510-134407532 CCCATGACAGGTGGGGATTGTGG - Intergenic
981030600 4:140121840-140121862 CCCATGACACGTGGGGATCATGG - Intronic
981242505 4:142493924-142493946 CCCATGACACATGGGGATTGTGG - Intronic
981307948 4:143266672-143266694 CCCATGACACATGGGAATTGTGG - Intergenic
981517166 4:145622121-145622143 CCCATGACACATGGGGATTGTGG - Intronic
982019785 4:151191439-151191461 CCCATGACACATGAGAATTGTGG - Intronic
982459508 4:155651088-155651110 CCCATGACACATGGGAATTGTGG + Intergenic
982496108 4:156093938-156093960 CCCATGACATGTGGGAATTGCGG + Intergenic
983006230 4:162489240-162489262 CCCATGACACGTGGGGATTATGG - Intergenic
983033305 4:162830489-162830511 CCCATGACACATGGGAATTGTGG - Intergenic
983489309 4:168369172-168369194 CCCATGACACATGGGAATTGTGG - Intronic
983760259 4:171396381-171396403 CCCATGACATGTGGGGATTGTGG - Intergenic
983860202 4:172696500-172696522 CCCATGACACGTGGGAATTATGG - Intronic
983899377 4:173117493-173117515 CCCATGACACGTGGGAATTATGG - Intergenic
983970112 4:173861169-173861191 CCCATGACACGTGGGAATTGTGG + Intergenic
984565757 4:181328421-181328443 CCCATGACGTGTGGGGATCGTGG - Intergenic
984733548 4:183089921-183089943 TCCATGACACGTGGGAATTGTGG + Intergenic
985160091 4:187034954-187034976 CCAATGACACATGTGAATTGTGG - Intergenic
985864605 5:2504618-2504640 CCCATGACACGTGGGGATTATGG - Intergenic
986111334 5:4721467-4721489 CCCATGACACGTGGGGATTATGG + Intergenic
986142026 5:5040073-5040095 CCCATGACACGTGGGGATTATGG + Intergenic
986267136 5:6200573-6200595 CCCATGACACGTGGGAATTGTGG - Intergenic
986685600 5:10273105-10273127 CCCATGACACGTGGGGATTATGG + Intergenic
986762044 5:10889144-10889166 CCCATGACACATGGGGATTGTGG + Intergenic
986780341 5:11059245-11059267 CCCATGACATGTGGGAATTGTGG - Intronic
986808654 5:11332783-11332805 CCCATGACACGTGGGAATTATGG - Intronic
986867518 5:12007580-12007602 CCCATGACACGTGGGGATTATGG + Intergenic
987000199 5:13652226-13652248 CCCATGACACATGGGGATTGTGG - Intergenic
987226513 5:15847444-15847466 CCCATGACACGTGGGGATTATGG + Intronic
987350867 5:17020604-17020626 CCCATGACATGTGGGAATTGTGG + Intergenic
987381327 5:17288713-17288735 CCCATGACATGTGGGAATTGTGG + Intergenic
987509191 5:18814397-18814419 CCCATGACATGTGGGAATTGTGG + Intergenic
987659681 5:20855774-20855796 CCCATGACACATGTGAACTGTGG - Intergenic
987683245 5:21164641-21164663 CCCTTGACACGTGGGGATCATGG + Intergenic
987939569 5:24515775-24515797 CCCATGACACGTGGGAATTGCGG - Intronic
987940677 5:24531708-24531730 CCCATGACACGTGGGAATTATGG + Intronic
988014553 5:25536758-25536780 CCCATGACACGTGGGAATTATGG + Intergenic
988185264 5:27853047-27853069 CCCATGACACATGGGAATTGTGG - Intergenic
988311617 5:29565962-29565984 CCCACGACACGTGGGAATTGTGG + Intergenic
988356842 5:30187658-30187680 CCCATGACATGTGGGAATTGTGG - Intergenic
988763963 5:34349873-34349895 CCCATGACACATGTGAACTGTGG + Intergenic
988817973 5:34853030-34853052 CCCATGACACGTGGGGATTATGG + Intronic
988870136 5:35380398-35380420 CCCATGACACATGGGAATTGTGG - Intergenic
988885936 5:35558374-35558396 CCCATGACATGTGGGAATTGTGG + Intergenic
989340368 5:40367584-40367606 CCTATGACACGTGTGGATTACGG + Intergenic
989515114 5:42334132-42334154 CTCATGACACGTGGGTATTATGG - Intergenic
990178281 5:53131450-53131472 CCCATGACATGTGGGGATTGTGG + Intergenic
990202120 5:53387431-53387453 CCCATGACACGTGGGCATTATGG + Intergenic
990204503 5:53414301-53414323 CCCATGACACGTGGGAATTATGG + Intergenic
990644434 5:57828013-57828035 CCCATGACACGTGGGGATTATGG + Intergenic
991119308 5:62993410-62993432 CCCATGACATGTGGGAATTGTGG + Intergenic
991119573 5:62995338-62995360 CCCATGACATGTGGGAATTGTGG + Intergenic
991259634 5:64652946-64652968 CCCATGACATGTGGGAATAGTGG + Intergenic
991261052 5:64668827-64668849 CCCATGACACGTGGGGATTATGG - Intergenic
991575357 5:68097713-68097735 CCCATGACATGTGGGAATTGTGG - Intergenic
992018399 5:72598489-72598511 CCCATGACACGTGAGGATTATGG + Intergenic
992357719 5:76002958-76002980 CCCATGACACGTGGGGATTATGG - Intergenic
992601759 5:78408366-78408388 CCCATGACACGTGGGAATTATGG + Intronic
992912316 5:81408062-81408084 CCCATGACACGTGGGGATTATGG + Intergenic
992973012 5:82082105-82082127 CCCATGACACATGGGAATTGTGG + Intronic
993015294 5:82528463-82528485 CCCATTACACGTGGGGATTGTGG + Intergenic
993200662 5:84811775-84811797 CCCATGACATGTGGGTATTATGG - Intergenic
993210560 5:84945449-84945471 CCCATGACACGTGGGGATTATGG - Intergenic
993431398 5:87836416-87836438 CCCATGACATGTGGGAATTGTGG + Intergenic
993561501 5:89416754-89416776 CCCATGACACATGGGTATTATGG - Intergenic
993889989 5:93462181-93462203 CCCATGACATGTGGGAATTGTGG - Intergenic
993950675 5:94171123-94171145 CCCATGACATGTGGGAATTGTGG - Intronic
994150822 5:96445781-96445803 CCCATGGTACGTGTGAATCTGGG + Intergenic
994271386 5:97782105-97782127 CCCATGACACATGAGAATTGTGG + Intergenic
994271642 5:97784025-97784047 CCCATGACACATGTAAATTGTGG + Intergenic
994328715 5:98480781-98480803 CCCAAGACACGTGGGAATTGTGG + Intergenic
994398192 5:99245202-99245224 CCCATGACACGTGGGAATTACGG + Intergenic
994428949 5:99630751-99630773 CCCATGACACGTGGGAATTGTGG + Intergenic
994655850 5:102592601-102592623 CCCATGACACATGGGAATTGTGG + Intergenic
994688443 5:102986705-102986727 CCCATGACACATGGGAATTGTGG - Intronic
994762694 5:103876638-103876660 CCCATGACACGTGGGAATTATGG + Intergenic
995212335 5:109554217-109554239 CCCATGACACGTGGGAATTATGG + Intergenic
995241825 5:109893608-109893630 CCCATGACATGTGGGAATTGTGG + Intergenic
995814009 5:116145663-116145685 CCCTTGACACGTGGGGATTGTGG - Intronic
995875214 5:116782688-116782710 CCCATGACACGTGGGAATTATGG + Intergenic
995931710 5:117454630-117454652 CCCATGACACGTGGGAATTATGG - Intergenic
995996226 5:118304028-118304050 CCCATGATACGTGGGGATTGTGG - Intergenic
996122146 5:119684602-119684624 CCCATGACACGTGGGGATTATGG + Intergenic
996150132 5:120024280-120024302 CCCATGACACGTGGGGATTTGGG - Intergenic
996243230 5:121227657-121227679 CTCATGACACGTGGGAATTGTGG - Intergenic
996333090 5:122353531-122353553 CCCATGACATGTGGGAATTGTGG - Intronic
996598915 5:125238349-125238371 CCCATGACACGTGGGGATGGTGG + Intergenic
996627718 5:125589552-125589574 CCCATGACACATGGGGATTGTGG + Intergenic
996928703 5:128860185-128860207 CCCATGACATGTGAGAATTGTGG + Intronic
997086258 5:130803455-130803477 CCCATGACATGTGGGAATTGTGG + Intergenic
997148595 5:131466491-131466513 CCCATGACATGTGGGAATTGTGG - Intronic
997300788 5:132802789-132802811 CCCATGACACGTGGGAATTTTGG - Intronic
997671805 5:135680751-135680773 CCCATGACACGTGGAGATTGTGG + Intergenic
998568781 5:143238971-143238993 CCCATGACATGTGGGAATTGCGG + Intergenic
999355365 5:150924486-150924508 CCCATGACACGTGGGGATTATGG - Intergenic
999864246 5:155683829-155683851 CCCATGACACATGGGAATTGTGG - Intergenic
999960834 5:156753823-156753845 CCCATGACACGTGGGGATTATGG + Intronic
1000527126 5:162371310-162371332 CCCATGACAAGTGGGGATTGTGG + Intergenic
1000637914 5:163664687-163664709 CCCATGACACGTGGGGATTATGG - Intergenic
1000751526 5:165101053-165101075 CCCATGACACGTGGGAATTATGG + Intergenic
1000761733 5:165233966-165233988 CCCATGACACATGGGAATTGTGG + Intergenic
1000973074 5:167736296-167736318 CCCATGACACGTGAGGATTATGG + Intronic
1001078443 5:168647797-168647819 CCCATGACACATGGGGATTGTGG + Intergenic
1001473580 5:172033246-172033268 CCCATGACACGTGGGGATTATGG + Intergenic
1001684796 5:173585355-173585377 CCCATGACATGTGGGAATTGTGG + Intergenic
1003352085 6:5327406-5327428 CCCATGACACGTGGGGATTATGG - Intronic
1004091642 6:12508786-12508808 CCCTTGACACGTGGGTATTATGG - Intergenic
1004578097 6:16918854-16918876 CCCATGACACGCGGGAATCGTGG + Intergenic
1004700580 6:18075590-18075612 CCCATGACACGTGGGGATTATGG + Intergenic
1005676145 6:28157311-28157333 CCCACGACACGTGGGAATTGTGG + Exonic
1005922411 6:30414497-30414519 CCCATGACAGGTGGGAATTGTGG + Intergenic
1006657960 6:35612831-35612853 CCCACGACACGTGGGGATTGTGG + Intronic
1007179362 6:39917396-39917418 CCCATGACACGTGGGGATTATGG + Intronic
1008242092 6:49126451-49126473 CCCATGACACATGGGAATTGTGG - Intergenic
1008411033 6:51180129-51180151 CCCATGACACATGGGAATTGTGG - Intergenic
1008859518 6:56132711-56132733 CCCATGACAAGTGGGAATTGTGG - Intronic
1008992945 6:57625082-57625104 CCCATGACACGTGGGAATTATGG + Intronic
1009181560 6:60524187-60524209 CCCATGACACGTGGGAATTATGG + Intergenic
1009517987 6:64643629-64643651 CCCATGACATGTGTGAATTGTGG - Intronic
1009735266 6:67669075-67669097 CCCATGACACGTGGGGATTATGG - Intergenic
1009765705 6:68072594-68072616 CCCATGACACATTTATATGGTGG - Intergenic
1009902484 6:69824673-69824695 CCCATGGCACGTGGGTATTATGG + Intergenic
1010163482 6:72887417-72887439 ACCATGACACGTGGGAATTGTGG + Intronic
1010450286 6:75994724-75994746 CCCATGACACATGGGAATTGTGG + Intronic
1011144365 6:84196135-84196157 CCCATGACACATGAGAATTGTGG - Intronic
1011170812 6:84502742-84502764 CCCATGACACATGGGAATTGTGG - Intergenic
1011263937 6:85496526-85496548 CCCATGACACGTGGGGATTATGG + Intergenic
1011457844 6:87571113-87571135 CCCATGACACGTGGGGATTATGG - Intronic
1012213638 6:96556182-96556204 CCCATGACACGTAGGAATTGTGG + Intergenic
1012771998 6:103449864-103449886 CCCATGACACGTGGGGATTATGG + Intergenic
1012849646 6:104431446-104431468 CCCATGACACATGGGAATTGTGG - Intergenic
1013539675 6:111095610-111095632 CCCATGACAAGTGTGGATTATGG - Intronic
1013806368 6:114000200-114000222 CCCATGACACCTGGGAATTGTGG + Intronic
1014236962 6:118968987-118969009 CCCATGACACATGGGGATTGTGG - Intronic
1014270098 6:119326798-119326820 CCCTTGACACGTGGGGATTGTGG + Intronic
1014525647 6:122498396-122498418 CCCATGACATGTGGGAATAGTGG + Intronic
1014665474 6:124231516-124231538 CCCATGACACGTGGGAATTATGG - Intronic
1014713569 6:124838290-124838312 CCCATGACACGTGGGGATTATGG - Intergenic
1014828493 6:126074052-126074074 CCCATGACACGTGGGGATTATGG + Intergenic
1015694564 6:135965718-135965740 CCCATGACACATGGGAATTGTGG + Intronic
1015784242 6:136904490-136904512 CCCATGACACATGGGAATTGTGG - Intronic
1015823990 6:137292743-137292765 CCCATGACATGTGGGAATTGTGG - Intergenic
1015839321 6:137459968-137459990 CCCATGACACATGGGGATTGTGG + Intergenic
1016177695 6:141100025-141100047 CCCATGACATGTGGGAATTGTGG - Intergenic
1016355109 6:143210020-143210042 CCCATGACACGTGGGGATTATGG - Intronic
1016520142 6:144937734-144937756 CCCATGACACATGGGAATTGTGG + Intergenic
1016620881 6:146108304-146108326 CCCATGACACATGGGAATTGTGG - Intronic
1017204604 6:151791230-151791252 CCCATGACACGTGGGAATTATGG - Intronic
1017295249 6:152786003-152786025 CCCATGACATGTGGGAATTGTGG + Intergenic
1017444421 6:154494368-154494390 CCCATGACACGTGGGGATTATGG + Intronic
1017461113 6:154651428-154651450 CCCATGACATGTGGGAATTGTGG + Intergenic
1017555627 6:155563605-155563627 CCCATGACACGTGGGAATTGTGG + Intergenic
1018041129 6:159922950-159922972 CCCATGACATGTGGGAATCATGG - Intergenic
1019085152 6:169468575-169468597 CCCATGACACATGGGGATTGTGG + Intronic
1019954410 7:4401960-4401982 CCCATGACACGTGGGGATTATGG + Intergenic
1020847428 7:13305133-13305155 CCCATGACATGTGGGAATTGTGG - Intergenic
1020986932 7:15147525-15147547 CCCATGACACGTGGGAATTATGG + Intergenic
1021485615 7:21165311-21165333 CCCATGACACGTGGGAATTATGG + Intergenic
1022000981 7:26225773-26225795 CCCATGACACGTGGGGATTATGG + Intergenic
1022519851 7:30999110-30999132 CCCATGACACGTGGGGATTATGG + Intergenic
1022671051 7:32456651-32456673 CCCATGACATGTGGGAATTGTGG - Intergenic
1023060769 7:36323671-36323693 CCCATGACACGTGGGAATCTTGG - Intergenic
1023293227 7:38688801-38688823 CCCATGACATGTGGGAATTGTGG + Intergenic
1024905972 7:54380779-54380801 CCCATGACACGTGGGAATTATGG - Intergenic
1026086538 7:67267671-67267693 CCCATGACTGGGGTGTATAGGGG - Intergenic
1026241657 7:68580813-68580835 CCCATGAAACGTGGGAATTGTGG + Intergenic
1026606870 7:71824012-71824034 CCCATGACACGTGGGAATTGTGG + Intronic
1026610784 7:71858080-71858102 CCCATGACACGTGGGGATTATGG - Intronic
1026631472 7:72041709-72041731 CCCATGACACGTGGGAATTACGG - Intronic
1026640450 7:72119840-72119862 CCCATGACATGTGGGAATTGTGG + Intronic
1026922507 7:74166537-74166559 CCCATGACACGTGGGGATTATGG + Intergenic
1027419440 7:78005257-78005279 CCCATGACATGTGGGAATTGTGG - Intergenic
1027690228 7:81336424-81336446 CCCATGACATGTGGGAATTGTGG + Intergenic
1027874738 7:83754613-83754635 CCCATGACACATGGGAATTGTGG + Intergenic
1028455970 7:91038694-91038716 CCCATGACACGTGGGAATTGTGG - Intronic
1028817804 7:95167318-95167340 CCCATGACATGTGGGAATTGTGG + Intronic
1028844737 7:95466936-95466958 CCCATGACACGTGGGGATTATGG + Intergenic
1029184081 7:98726198-98726220 CCCATGACACGTGGGGATTATGG - Intergenic
1029691125 7:102182546-102182568 CCCATGACACACGTGGATAGCGG - Intronic
1030453278 7:109740342-109740364 CCCATGACATGTGGGAATTGTGG + Intergenic
1030510783 7:110480223-110480245 CCCATGACACTTGGGAATTGTGG + Intergenic
1030527519 7:110672348-110672370 CCCATGACATGTGGGGATTGTGG + Intronic
1030545948 7:110895273-110895295 CCCATGACATGTGGGAATTGTGG + Intronic
1031158307 7:118136222-118136244 CCCATGACACATGGGAATTGTGG - Intergenic
1031700026 7:124913178-124913200 CCCATGACACATGGGAATTGTGG + Intronic
1032534678 7:132652928-132652950 CCCATGACATGTGGGAATTGTGG - Intronic
1032884229 7:136120834-136120856 CCCATGACATGTGGGAATTGTGG + Intergenic
1033171280 7:139086671-139086693 CCCATGACACGTGGGGATTATGG - Intronic
1033429566 7:141276636-141276658 CCCATGACACGTGGGGATCATGG + Intronic
1033792483 7:144807420-144807442 CCCATGACACGTGGGAATTATGG + Intronic
1034516896 7:151588256-151588278 CCCATGACACGTGGGAATTATGG - Intronic
1034751486 7:153572765-153572787 CCCATGACACGTGGGGATTATGG + Intergenic
1034852033 7:154502401-154502423 CCCATGACACATGGGGATTGTGG - Intronic
1035048926 7:155987208-155987230 CCCATGACACGTGGGGATTATGG - Intergenic
1035321764 7:158034352-158034374 CCCATGACACATGGGAATTGTGG - Intronic
1035834934 8:2740023-2740045 CCCATGACACGTGGGGATTATGG - Intergenic
1035840753 8:2810026-2810048 CCCATCACATGCCTGTATCGTGG + Intergenic
1035884399 8:3276582-3276604 CCCATGATACGTGGGAATTGTGG + Intronic
1035955635 8:4076096-4076118 CCCATGACACGTGGGGATTATGG - Intronic
1036114118 8:5940222-5940244 CCCATGACAAGTGGGAATTGTGG + Intergenic
1036629981 8:10505609-10505631 CCCATGACACGTGGGGATTACGG - Intergenic
1037003241 8:13746933-13746955 CCCATGACACATGGGAATTGTGG + Intergenic
1037155619 8:15695212-15695234 CCCATGACATGTGGGAACCGTGG - Intronic
1037448776 8:18995869-18995891 CCCATGACACGTGGGGATTATGG + Intronic
1037660405 8:20921271-20921293 CCCATGACACGTGGGGATTATGG + Intergenic
1037679882 8:21088442-21088464 CCCATGACATGTGAGAATTGTGG - Intergenic
1038159257 8:25021195-25021217 CCCATGACACGTGGGGATTATGG - Intergenic
1038280276 8:26158169-26158191 CCCATGACATGTGGGAATTGTGG + Intergenic
1038345057 8:26725093-26725115 CCCATGACACGTGGGGATCGTGG - Intergenic
1038572255 8:28672847-28672869 CCCATGACACGTGAGAATTGTGG - Intronic
1038821874 8:30959344-30959366 CCCATGACATGTGGGAATTGTGG + Intergenic
1039014787 8:33134522-33134544 CACATGACACGTGGGGATTGTGG + Intergenic
1039089866 8:33816201-33816223 CCCATGACCCGTGGGAATTGTGG + Intergenic
1039491274 8:37949306-37949328 CCCATGACATGTGAGAATTGTGG - Intergenic
1040650633 8:49445527-49445549 CCCATGACACGTGGGGATTATGG - Intergenic
1041066844 8:54090767-54090789 CCCTTGACACATGGGTATTGTGG - Intronic
1041333890 8:56758163-56758185 CCCATGACACGTGGGGATTATGG + Intergenic
1041487927 8:58399447-58399469 CCCATGACACGTGGGGATTATGG + Intergenic
1041861896 8:62523777-62523799 CCCATAGCAAGTGTGTATCGCGG + Intronic
1041955346 8:63553315-63553337 CCCATGACACATGGGTATTATGG + Intergenic
1042193462 8:66211523-66211545 CCCATGACACGTGGGGATTATGG + Intergenic
1042940270 8:74100246-74100268 CCCATGACACGTGGGAAATGTGG + Intergenic
1042969657 8:74394301-74394323 CCCATGACACGTGGAAATTGTGG + Intronic
1043317104 8:78936714-78936736 CCCATGACACGTGGGAATTGTGG - Intergenic
1043385848 8:79747294-79747316 CCCATGACACGTGGGAATTGTGG + Intergenic
1043663423 8:82776551-82776573 CCAATGACACGTGGGGATTGTGG - Intergenic
1043757578 8:84022414-84022436 CCCATAACACGTGGGAATTGTGG - Intergenic
1043806063 8:84672809-84672831 CCCATGACATGTGGGGATTGTGG + Intronic
1044168431 8:89018416-89018438 CCCATGACATGTGGGAATTGTGG + Intergenic
1044409087 8:91865439-91865461 CCCATGACACGTGGGGATTATGG + Intergenic
1044758082 8:95488126-95488148 CCCATGACATGTGGGAATTGTGG - Intergenic
1044847749 8:96398718-96398740 CCCACGACACGTGGGAATTGTGG + Intergenic
1045618035 8:103940424-103940446 CCCATGACACAAGGGTATTGTGG + Intronic
1045800213 8:106093294-106093316 CCCATGACACGTGGGAATTGTGG + Intergenic
1046003998 8:108457702-108457724 CCCATGACATATGTGAATTGTGG + Intronic
1046146935 8:110172604-110172626 CCCATGACACGTGGGTATTATGG - Intergenic
1046310276 8:112427299-112427321 CCCATGACACATGGGTATTATGG - Intronic
1046492320 8:114968573-114968595 CCCATGACATGTGGGAATAGTGG - Intergenic
1046525216 8:115374677-115374699 CCCATGACACGTGGGGATTGTGG - Intergenic
1046561645 8:115845330-115845352 CCCATGACATGTGGGAATTGTGG + Intergenic
1046694330 8:117321739-117321761 CCTATGACACATGGGTATTGTGG + Intergenic
1046917258 8:119691011-119691033 CCTATGACACGTGGGTATTATGG - Intergenic
1046968692 8:120195794-120195816 CCCATGACACGTGGGAATTATGG + Intronic
1047026117 8:120826440-120826462 CCCATGACACATGGGAATTGTGG - Intergenic
1047565456 8:126039446-126039468 CCCATGACACATGGGAATTGTGG - Intergenic
1048026117 8:130588436-130588458 CCCATGACATGTGGGAATTGTGG + Intergenic
1048083814 8:131156593-131156615 CCCATGACACATGGGAATTGTGG - Intergenic
1048189175 8:132272762-132272784 CCCATGACATGTGGGAATTGTGG + Intronic
1048363870 8:133721297-133721319 CCCATGACACATGGGAATTGTGG - Intergenic
1048404703 8:134107661-134107683 CCCATGACATGTGGGAATTGTGG - Intergenic
1048419185 8:134260501-134260523 CCCATGACATGTGAGAATTGTGG - Intergenic
1048613626 8:136050828-136050850 CCCATGACACATGGGTATTACGG - Intergenic
1048660772 8:136598830-136598852 CCCATGACATGTGGGAATTGTGG - Intergenic
1048960897 8:139575906-139575928 TCCATGACACGTGGGAATTGCGG - Intergenic
1050128883 9:2388844-2388866 CCCATGACACGTGAGAATTGTGG + Intergenic
1050611916 9:7362074-7362096 CCCACGACACGTGGGAATTGTGG - Intergenic
1050985037 9:12071674-12071696 CCCATGACATGTGGGGATTGTGG - Intergenic
1051088937 9:13384045-13384067 CCCATGACATTTGTGAATTGTGG - Intergenic
1051155665 9:14142180-14142202 CCCATGTCACGTGGGAATTGTGG - Intronic
1051220214 9:14840626-14840648 CCCATGACACGTGGGAATTGTGG + Intronic
1051361372 9:16284644-16284666 CCCATGACACGTGGGGATTATGG - Intergenic
1051483769 9:17586789-17586811 CCCATGACACATGGGGATTGTGG + Intronic
1051644325 9:19252338-19252360 CCCATGACATGTGGGAATTGTGG + Intronic
1051743767 9:20275976-20275998 CCCATGACACGTGGGGATTATGG + Intergenic
1051957311 9:22712094-22712116 CCCATGACACATGGGAATTGTGG - Intergenic
1051979658 9:22998445-22998467 CCCATGACATGTGAGGATTGTGG + Intergenic
1052080935 9:24204242-24204264 CCCATGACATGTGGGAATTGTGG - Intergenic
1052557010 9:30031353-30031375 CCCATGACACGTGGGAATTATGG + Intergenic
1053397962 9:37791661-37791683 CCCATGACACATGGGAATTGTGG + Intronic
1054708335 9:68485366-68485388 CCCATGACACGTGGGGATTATGG - Intronic
1055285638 9:74725516-74725538 CCCATGACACGTGGGAATTGTGG - Intronic
1055379536 9:75690884-75690906 CCCATGACACATGGGAATTGTGG + Intergenic
1055578525 9:77683713-77683735 CCCACGACACGTGGGTATTACGG + Intergenic
1056012270 9:82344939-82344961 CCCATGACAAGTGGGAATTGTGG - Intergenic
1056042708 9:82684989-82685011 CCCATGACACGTGGGGATTACGG + Intergenic
1056279524 9:85027783-85027805 CCCAAGAGATGTGTGTATTGTGG + Intergenic
1057541269 9:95973700-95973722 CCCATGACACATGGGGATTGTGG + Intronic
1057749262 9:97778603-97778625 CCCATGACACGTGGGGATTATGG - Intergenic
1057982871 9:99679823-99679845 CCCATGACACGTGGGGATTATGG - Intergenic
1058065526 9:100544517-100544539 CCCACGACACGTGGGAATTGTGG + Intronic
1058111906 9:101039843-101039865 CCCATGACACATGGGAATTGTGG + Intronic
1058592648 9:106582104-106582126 CCCATGACACGTGGGGATTATGG + Intergenic
1058929017 9:109700201-109700223 CCCATGACACGTGGGGATTATGG - Intronic
1059118863 9:111623327-111623349 CCCATGACACGTGGGGATTATGG + Intergenic
1059213190 9:112533835-112533857 CCCTTGACACGTGGGGATTGTGG + Intronic
1059572764 9:115458250-115458272 CCCATGACTAGTGTCTATAGTGG + Intergenic
1059578860 9:115521852-115521874 ACCATGACACGTGGGTATTATGG - Intergenic
1061754504 9:132803207-132803229 CCCATGACACGTGAGGATTATGG + Intronic
1062434777 9:136542064-136542086 CCCATGACACCAGTGTTTTGCGG + Intronic
1062680327 9:137775650-137775672 CCCATGACAAGGGTGTACTGAGG + Intronic
1203617577 Un_KI270749v1:82212-82234 CCCATGACATGTGTGGATTATGG - Intergenic
1185552348 X:993206-993228 CCCATGACACGTGGGAATTTTGG - Intergenic
1185849246 X:3469905-3469927 CCCATGACACATGGGAATTGTGG + Intergenic
1185946588 X:4383964-4383986 CCCATGACACGTGGGAATTATGG - Intergenic
1185986419 X:4839476-4839498 CCCATGACATGTGGGGATTGTGG + Intergenic
1186133746 X:6496872-6496894 CCCATGACACGTGAGGATTATGG - Intergenic
1186222571 X:7365475-7365497 CCCAGGACACGTGGGAATTGTGG - Intergenic
1186222846 X:7367428-7367450 CCCATGACACATGGGAATTGTGG - Intergenic
1186223754 X:7375820-7375842 CCCATGACATGTGGGAATTGTGG - Intergenic
1186233199 X:7478375-7478397 CCCATGACACGTGGGGATTTTGG + Intergenic
1186261316 X:7782795-7782817 CCCATGACACATGGGGATTGTGG + Intergenic
1186675918 X:11817156-11817178 CCCATGACATGTGGGAATTGTGG + Intergenic
1187069990 X:15878811-15878833 CCCATGACACGTGGGCATTATGG + Intergenic
1187180225 X:16936925-16936947 CCCATGACACGTGGGAATTATGG + Intergenic
1187214796 X:17265568-17265590 CCCATGACACATGGGAATTGTGG - Intergenic
1187290763 X:17951134-17951156 CCCATGACACGTCGGTATTATGG + Intergenic
1187368365 X:18683133-18683155 CCCACGACACGTGGGAATTGTGG + Intronic
1187433386 X:19244948-19244970 CCCATGATACGTGGGAATTGTGG - Intergenic
1187560871 X:20402226-20402248 CCCATGACACGTGGGGATTATGG + Intergenic
1187598261 X:20798923-20798945 CCCATGACACGTGGGGATTATGG - Intergenic
1187675661 X:21713685-21713707 CCCATGACACATGTGAATTATGG + Intronic
1187683606 X:21794035-21794057 CCCATGACATGTGGGAATCATGG - Intergenic
1187792669 X:22967963-22967985 CCCATGACACGTGGGAATTATGG + Intergenic
1188071701 X:25726195-25726217 CCCATGACACGTGGGTATTATGG - Intergenic
1188124390 X:26350559-26350581 CCCATGACACGTGGGGATTATGG + Intergenic
1188124700 X:26352756-26352778 CCCATGACACGTGGGGATTATGG + Intergenic
1188144313 X:26590669-26590691 CCCAGGACACGTGTGGATTATGG + Intergenic
1188292585 X:28407159-28407181 CCCATGACACGTGGGGATTATGG + Intergenic
1188325400 X:28796174-28796196 CCCATGACAGGTGGGAATTGTGG + Intronic
1188325682 X:28798112-28798134 CCCATGACAGGTGGGAATTGTGG + Intronic
1188447671 X:30273232-30273254 CCCATGACACGTGGGAATTATGG - Intergenic
1188860345 X:35248156-35248178 CCCATGACATGTGGGAATTGTGG - Intergenic
1189253884 X:39622422-39622444 CCCATGACACATGGGAATTGTGG + Intergenic
1189306338 X:39989583-39989605 CCCATGACACGTGTAGATTATGG - Intergenic
1189408532 X:40748327-40748349 CCCATGACACGTGGGAATTGTGG - Intergenic
1189412135 X:40781831-40781853 CCCATGACACGTGGGAATTATGG - Intergenic
1189649522 X:43174386-43174408 CCCATGACACGTGGGAATTATGG + Intergenic
1189960795 X:46323207-46323229 CCCATGACATGTGGGAATTGTGG + Intergenic
1193308084 X:79973024-79973046 CCCATGACACATGGGAATTGTGG - Intergenic
1193320522 X:80115682-80115704 CCCATGACACGTGCAAATCATGG - Intergenic
1193387123 X:80885257-80885279 CCCATGACACGTGGGGATTATGG - Intergenic
1193622727 X:83776654-83776676 ACCATGGCACGTGTGTACCTAGG - Intergenic
1193630157 X:83875663-83875685 CCCACGACATGTGTGAATTGTGG + Intronic
1193840861 X:86406052-86406074 CCCATGACACATGGGGATTGTGG + Intronic
1194032869 X:88837356-88837378 CCCTTGACACGTGGGTATTAGGG + Intergenic
1194442769 X:93953591-93953613 CCCATGACACATGGGTATTATGG - Intergenic
1194447318 X:94004642-94004664 CCCATGACACCTGGGGATCATGG - Intergenic
1194611100 X:96046759-96046781 CCCATGACACATGGGGATCATGG - Intergenic
1196062873 X:111430402-111430424 CCCATGACACGTGGGGATTATGG - Intergenic
1196321899 X:114351155-114351177 CCCATGACACGTGGGAATTATGG - Intergenic
1196576187 X:117322003-117322025 CCCATGACACGTGGGGATTATGG - Intergenic
1196665003 X:118306321-118306343 CCCATGGCACGTGGGAATTGTGG + Intergenic
1196826110 X:119741550-119741572 CCCACGACACGTGGGAATTGTGG - Intergenic
1197074630 X:122340290-122340312 CCCATGACATGTGAGTATTATGG + Intergenic
1197466319 X:126807937-126807959 CCCATGACACATGGGAATTGTGG - Intergenic
1197642731 X:128985030-128985052 GCCATGACACGTGGGAATTGTGG - Intergenic
1197688762 X:129474789-129474811 CCCATGACACATGGGAATTGTGG - Intronic
1198007784 X:132516346-132516368 CCCATGACATGTGGGAATTGTGG - Intergenic
1198781558 X:140242728-140242750 CCCATGACACGTGGGGATTATGG - Intergenic
1199619206 X:149684635-149684657 CCCATGACACGTGGGGATTATGG - Intergenic
1200814417 Y:7516893-7516915 CCCATGACACCTGGGAATTGTGG - Intergenic
1200817509 Y:7548777-7548799 CCCATGACACGTGGGGATTATGG + Intergenic
1201489894 Y:14528617-14528639 CCCATGACACATGGGGATTGTGG + Intronic
1201637027 Y:16135166-16135188 CCCATGACATGTGGGAATTGTGG - Intergenic
1201712647 Y:17009505-17009527 CCCTTGACACGTGGGAATTGTGG - Intergenic