ID: 1155518825

View in Genome Browser
Species Human (GRCh38)
Location 18:26649161-26649183
Sequence AGTCACGTGCTGCCAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155518825_1155518831 25 Left 1155518825 18:26649161-26649183 CCATTCCCTGGCAGCACGTGACT 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1155518831 18:26649209-26649231 CTAGTATTCCTGATCACTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 118
1155518825_1155518829 -10 Left 1155518825 18:26649161-26649183 CCATTCCCTGGCAGCACGTGACT 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1155518829 18:26649174-26649196 GCACGTGACTGCCTAAGACTGGG 0: 1
1: 0
2: 0
3: 1
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155518825 Original CRISPR AGTCACGTGCTGCCAGGGAA TGG (reversed) Intronic
902816625 1:18919881-18919903 GGGCACCTGCAGCCAGGGAAGGG + Intronic
904450676 1:30609412-30609434 AAGCAGGTGCTCCCAGGGAAAGG + Intergenic
906668364 1:47637641-47637663 AGACACTTTCTGCCAGGTAAGGG - Intergenic
907157283 1:52346091-52346113 ATTCATGTACTGCGAGGGAAGGG - Exonic
907902201 1:58751187-58751209 AGTCTGGTGCTGCCAGGAAAAGG - Intergenic
910266503 1:85343391-85343413 AGGCAACTGCTGCCAGGAAAAGG + Intronic
912389342 1:109291319-109291341 AGTCACATGATTCAAGGGAAGGG + Intergenic
913238353 1:116804798-116804820 TGTCAAGTGCTGCCAGTGATGGG - Intergenic
919168887 1:193928953-193928975 AGTCAAGTGTTCCCAGAGAAAGG + Intergenic
920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG + Intergenic
921302368 1:213763448-213763470 AGTCTGCTGCTGCCAGGAAAAGG + Intergenic
923384095 1:233449393-233449415 TGGCAGGTGGTGCCAGGGAAAGG + Intergenic
923413253 1:233730813-233730835 AGTCAACTGCTGACAGGGTAGGG + Intergenic
923858842 1:237872575-237872597 AGGCAGGTGCTACCATGGAAAGG + Intergenic
1062806068 10:420382-420404 AGTCACGGGTTCCCAGTGAACGG - Intronic
1063152282 10:3347580-3347602 AGTCCCGTGCTGACAGTGCAGGG - Intergenic
1064209851 10:13352654-13352676 AGTCTAGTGGGGCCAGGGAAGGG - Intergenic
1065047288 10:21755672-21755694 TGTCACCTCCTGTCAGGGAAAGG + Intergenic
1066088453 10:31994219-31994241 TTTCATGTGCTGCCATGGAAAGG - Intergenic
1067526557 10:47042856-47042878 AGCAAGGTGCTGCCATGGAAGGG + Intergenic
1069289773 10:66763909-66763931 TGTCACATACTGGCAGGGAATGG - Intronic
1074412966 10:113243718-113243740 AGTCACCTGCTGCCAGGTCTAGG + Intergenic
1074537389 10:114338266-114338288 GGCCAAGTCCTGCCAGGGAAGGG - Intronic
1076128708 10:127996204-127996226 AGTTACGTGTTGCCAAGCAACGG - Intronic
1076351177 10:129816149-129816171 GCTCACAAGCTGCCAGGGAAGGG - Intergenic
1076749640 10:132536354-132536376 AGACACCTGCTGCCAGGGCGGGG - Intergenic
1077899893 11:6479733-6479755 ACTCAGGTGGTGGCAGGGAAAGG + Intronic
1078089005 11:8252309-8252331 GGTCACCTCATGCCAGGGAAGGG - Intronic
1083306382 11:61764155-61764177 AGTCACGCGCTGCCTGCGACAGG - Intronic
1085694218 11:78690101-78690123 AGTCAGGTTCTGCCAGGAAAAGG + Intronic
1087247146 11:95852745-95852767 ATTCACGTGCTGGCCGGGCACGG + Intronic
1090731217 11:129574634-129574656 ACTCACGTGATGCCAGAGAAAGG + Intergenic
1091077574 11:132634516-132634538 AGTTACATGCTTCAAGGGAAGGG + Intronic
1091269089 11:134293087-134293109 AGACAAGTGCTGTCAGGGAAGGG - Intronic
1096509168 12:52117967-52117989 AGTCAGGTGCGCCAAGGGAACGG - Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1103870099 12:124085257-124085279 AGTGATGTGCTGGCAGGGATGGG + Intronic
1103911429 12:124354605-124354627 AGTCACGTGCTGCCGGAGCAGGG + Intronic
1104384276 12:128336695-128336717 TGTCTCCTGCTGCCAGGGAGCGG - Intronic
1105566780 13:21557179-21557201 AGTAACTTGTTGCCAGAGAATGG + Intronic
1107691588 13:42958702-42958724 GGTCACGTGCTGCAAATGAAAGG + Intronic
1112105243 13:96232688-96232710 AATCAGGTGCAACCAGGGAAGGG + Intronic
1116956788 14:50932210-50932232 AGTCAGTTGCTGGAAGGGAATGG - Intronic
1118225905 14:63899040-63899062 AGAATGGTGCTGCCAGGGAATGG - Intronic
1118798716 14:69168997-69169019 TGCCACGTGCTGGCAGGGAAGGG - Intergenic
1122146214 14:99690418-99690440 AATCACGTTCTCCCAGGGAAAGG - Intronic
1125375469 15:39024304-39024326 AGGCACGTGATGTCACGGAAAGG + Intergenic
1125676370 15:41504480-41504502 AGTTGAGTGCTGCCCGGGAAGGG - Intronic
1128307048 15:66605514-66605536 AGTCACCAGCTGCCAGAGGATGG - Intronic
1129108042 15:73322640-73322662 AGTGACGTGCTGGCCGGGGATGG + Exonic
1132253143 15:100349766-100349788 TCTCACGGGCTGCCAGGGAGCGG - Intergenic
1133717751 16:8465763-8465785 AGTGACTTTCTTCCAGGGAAGGG - Intergenic
1133856855 16:9557940-9557962 AGTCACGTGGTCCCAGAGAGAGG + Intergenic
1137408152 16:48206122-48206144 AGGCACTGGCTGCCAGGGAATGG - Intronic
1140150195 16:72355359-72355381 GGCCAGGAGCTGCCAGGGAAAGG + Intergenic
1142229670 16:88893934-88893956 AGTCCCTTGCTGACAGGGGAGGG + Intronic
1144729591 17:17518829-17518851 AGACGAGTGCTGCCAGGGACTGG + Intronic
1150236888 17:63600798-63600820 AGTACCGTGCAGCCACGGAACGG + Intergenic
1151339778 17:73463531-73463553 AATCACCTGGTGCCGGGGAAGGG - Intronic
1152120827 17:78417334-78417356 AGGCACGTCCAGCCAGGGATTGG + Intronic
1155518825 18:26649161-26649183 AGTCACGTGCTGCCAGGGAATGG - Intronic
1159691306 18:71491820-71491842 AGTCAGTTGTGGCCAGGGAAGGG - Intergenic
1160963137 19:1733546-1733568 AGTCAGGGGCAGCCAGGCAAGGG - Intergenic
1161374684 19:3933417-3933439 AGTCACGAGCTGGCCGGGCAGGG - Intronic
1161926806 19:7306906-7306928 AATCACGAGCTGCCAGGAGAGGG + Intergenic
1164480890 19:28610133-28610155 AGTCAGGTGCACCAAGGGAATGG + Intergenic
1165334047 19:35156762-35156784 AGTGAAGTGCAGCCAGGGCAGGG + Intronic
1168242035 19:55093225-55093247 AGTCACACCCTGGCAGGGAAAGG + Exonic
928443718 2:31314795-31314817 AGTCCTGAGCTGCCAGGGTAGGG + Intergenic
934660272 2:96139412-96139434 AGTCACCTGCACCCAGTGAAGGG + Intergenic
934813649 2:97305651-97305673 TGCCACCTGCTGACAGGGAAGGG - Intergenic
934824046 2:97402829-97402851 TGCCACCTGCTGACAGGGAAGGG + Intergenic
935674515 2:105582822-105582844 TGTTAAGTGCTTCCAGGGAAGGG + Intergenic
937929619 2:127193841-127193863 TTTCCAGTGCTGCCAGGGAACGG - Exonic
938873744 2:135510684-135510706 AGACTCGAGCTGCCAGGGAAGGG - Intronic
943434519 2:187847983-187848005 AGTCCTGAGCTGCCAGGGTAGGG + Intergenic
945485121 2:210386170-210386192 ACTCAAGTGCTTCCAGGGTATGG + Intergenic
947573096 2:231250668-231250690 AGTGAGGGGCTGCCAGGGAGAGG + Intronic
948524409 2:238561391-238561413 AGTCACGAGCAGCCAGGGAAGGG - Intergenic
948553013 2:238787177-238787199 AGGAACGTGATGCCAAGGAAGGG + Intergenic
1173591968 20:44231786-44231808 AGGCCCTTCCTGCCAGGGAAGGG - Intergenic
1173960528 20:47068319-47068341 AGCCATGTGCTGCCATGGAAAGG + Intronic
1174403556 20:50289417-50289439 ACTCAGGTGCTGCCAGGGCTGGG + Intergenic
1175140387 20:56856490-56856512 AATCACGTGCAGCCACTGAAGGG + Intergenic
1176137769 20:63532036-63532058 AGACAATCGCTGCCAGGGAATGG - Intronic
1181582375 22:23835378-23835400 GGTCCCATGCTGCCAGGGCAGGG + Intronic
1184861687 22:47176292-47176314 AGCCAAGTGCTGCCAAGGGAGGG - Intergenic
949929761 3:9069455-9069477 ATCCACTTGATGCCAGGGAAGGG + Intronic
950504529 3:13386433-13386455 AGTGAGGTGCGGACAGGGAATGG + Intronic
951534557 3:23729161-23729183 TGTCACCTGCAGCCAGGGAGAGG + Intergenic
953699580 3:45185420-45185442 AGAGAGGTGCTGCCAAGGAAGGG + Intergenic
961723431 3:128910553-128910575 AGTCACTTGCTGTTGGGGAAAGG + Intronic
962368684 3:134803226-134803248 TGTCACTTGCTGCCAGGAAGTGG - Intronic
966757573 3:183385790-183385812 ATTCTCTTGCTGCCAGGGAATGG + Intronic
968730052 4:2265246-2265268 AGGCAGGGGCTCCCAGGGAAGGG + Intergenic
968943174 4:3649933-3649955 AGTCAGGTGATGCTGGGGAATGG + Intergenic
970403886 4:15743799-15743821 AGTCATGAGCTCCCAGGAAAGGG + Intergenic
971530670 4:27684621-27684643 AGGCAGGTGCTGACAGGGAGCGG + Intergenic
975788894 4:77926200-77926222 AGTCATGTGCTGGCAAGGAAAGG - Intronic
978354235 4:107853841-107853863 AGTAACGTGGAGCAAGGGAAAGG + Intronic
979205468 4:118033354-118033376 CGTCTTGTGCGGCCAGGGAAAGG - Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
983418268 4:167485205-167485227 ATTCACCTGGCGCCAGGGAACGG - Intergenic
986073791 5:4313550-4313572 AACCACGTGCTGCCATGGAAGGG - Intergenic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988936649 5:36090116-36090138 AGTAACTTCCTGCCATGGAAAGG + Intergenic
991354258 5:65751212-65751234 AGTGACATGGTGACAGGGAAAGG + Intronic
995056647 5:107766582-107766604 AGTCCCTTGCAGCCAGGGACTGG + Intergenic
996520082 5:124416338-124416360 AGACAGGTGCTGCCTGGGACTGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997786272 5:136716877-136716899 AGTCAGATGCTGCTATGGAAAGG + Intergenic
999111523 5:149125565-149125587 AGCCACGGCTTGCCAGGGAAGGG + Intergenic
999264353 5:150256738-150256760 TGTCAGGTGCTGCCTGGCAATGG - Intronic
999585411 5:153084241-153084263 AGAAATGTGCTGCCATGGAAGGG - Intergenic
999993026 5:157066197-157066219 AGTCAAATGCTGCAAAGGAAAGG + Intergenic
1002098793 5:176847233-176847255 AGTCACGCGCTGGATGGGAACGG - Intronic
1005097439 6:22132737-22132759 AGTCACGGGAAGCCATGGAAAGG - Intergenic
1007433640 6:41792158-41792180 AGTCAGCGCCTGCCAGGGAAAGG + Exonic
1007713314 6:43838521-43838543 AGTGACCTGGGGCCAGGGAAGGG - Intergenic
1010821318 6:80419141-80419163 TCTCACGTGCTGACAGGGCAAGG + Intergenic
1010847366 6:80725798-80725820 ATTCACATGCCGCCAGAGAAAGG - Intergenic
1011752926 6:90471613-90471635 AGTCACGTGCTTCCAAGCCAAGG - Intergenic
1015294526 6:131575505-131575527 GGTCCCTTGCTGCCAGGGACAGG + Intronic
1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG + Intergenic
1021425650 7:20496311-20496333 AGTGAGGTGCTGGCAGGGACAGG - Intergenic
1029036568 7:97528620-97528642 CGTCACATGATGCCAGGTAAGGG - Intergenic
1029482794 7:100823335-100823357 AGCCAGGTGCAGTCAGGGAATGG + Intronic
1035546096 8:483484-483506 TGGCACATGCTGCCAGGGCAGGG + Intergenic
1035951097 8:4021961-4021983 AGTCAAGTGCTGCCTAGGAAAGG + Intronic
1036576128 8:10029307-10029329 AGACACCTGCTGTCAGGGAGAGG + Intergenic
1036595121 8:10205099-10205121 AGTCATGGGATGCCATGGAAGGG + Intronic
1038193263 8:25343296-25343318 AGTCAAGTGCTGACTGGGCACGG - Intronic
1041106926 8:54453696-54453718 AGTCGCCCGCTGCCAGGGAGGGG + Intergenic
1041378392 8:57225206-57225228 AGTCAAATGTTGCCAGAGAAAGG + Intergenic
1044764760 8:95559680-95559702 AATCACCTGCTGCCTTGGAAAGG - Intergenic
1044865686 8:96568910-96568932 AGTCACTGGGTGTCAGGGAAGGG + Intronic
1046344851 8:112910215-112910237 TTTCACGTGCAGCCAGGGATGGG + Intronic
1047205302 8:122798417-122798439 TCTCACATCCTGCCAGGGAATGG + Intronic
1048736739 8:137510379-137510401 AGTGATGGGCTGCCAGGCAATGG + Intergenic
1049160863 8:141096647-141096669 AGCCAGGTGCTCCCAGGGGACGG + Intergenic
1049376466 8:142291757-142291779 AGTCAGGGCCTGCCAGTGAAAGG + Intronic
1050355637 9:4780541-4780563 AGGCAGCTGCTGCCAGGGGATGG - Intergenic
1051920563 9:22259150-22259172 AGTCACATGCTGGCAGAGCAAGG - Intergenic
1052070409 9:24074705-24074727 AGTCTGGTGCTGCCAGTGACTGG + Intergenic
1055422295 9:76157114-76157136 ACACACGTGCTGCCGGGGAACGG - Exonic
1055666220 9:78555711-78555733 ACTCAAGTGCTGGCAGGGACAGG - Intergenic
1056887530 9:90457673-90457695 GGTCACATGCTGCCAGGGTAAGG - Intergenic
1058738441 9:107918815-107918837 AGCCACGTGCTGGCAGCGACGGG - Intergenic
1061563011 9:131418539-131418561 AGTCACTTGCTGCCAGAGACAGG + Intronic
1187225746 X:17374691-17374713 GGCCACGTGATGCCTGGGAAGGG + Intergenic
1188797183 X:34481459-34481481 ACACAAGTGCTGGCAGGGAAGGG + Intergenic
1189228306 X:39432122-39432144 AGTTATCTGCTGCCAGGGAGGGG + Intergenic
1193492447 X:82166032-82166054 ACACATGTGCTGGCAGGGAAAGG - Intergenic
1193921621 X:87434790-87434812 AGTCACATGTTTCCAGGGGAAGG - Intergenic
1195689786 X:107615057-107615079 AGTCACCTCCTGGCAGGGCATGG + Intergenic