ID: 1155519851

View in Genome Browser
Species Human (GRCh38)
Location 18:26656923-26656945
Sequence AGCCGCGGCGGAGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155519851 Original CRISPR AGCCGCGGCGGAGCGGCCGC GGG Intronic
900185680 1:1332116-1332138 GGCCGCCGCGGAGCTGCTGCAGG + Exonic
900616835 1:3569277-3569299 AGCCCCGGCTGAGGGGCGGCGGG - Intronic
901019749 1:6249680-6249702 GGCCGAGGCGGAGCGGGGGCCGG + Exonic
901040242 1:6359144-6359166 GGCCGCTGCTGAGCGGCCTCAGG + Intronic
901066639 1:6497456-6497478 AGCCGCGGCGGCCCCGCCTCGGG + Intronic
901645515 1:10714975-10714997 GCCCGCGGCTGAGCGGCGGCAGG - Intronic
902214121 1:14924039-14924061 CGCCGCGGCGGGGCGGGGGCGGG + Intronic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
903251101 1:22053294-22053316 GGCCGCGGCGGGGCGGTGGCAGG + Intronic
903738177 1:25543576-25543598 CGCCGCGGCGGAGCTGGCGCTGG + Exonic
904751053 1:32741734-32741756 AGCGGGGCGGGAGCGGCCGCAGG - Intergenic
905847114 1:41242242-41242264 AGGCGCGGGGGAGGGGCCGGGGG - Intergenic
905886842 1:41496291-41496313 AGCCGCGGCGGACCTGCAGGCGG + Intergenic
906055979 1:42917203-42917225 AGCAGCTGCGGAGGGGGCGCCGG - Intergenic
906640727 1:47439067-47439089 AGGCGCGGCGGCGCGGCCTGGGG - Exonic
907474715 1:54698089-54698111 AGCCGGGGCGGAGGGGACGAGGG - Intronic
910200113 1:84690466-84690488 CGCAGCGGAGGAGGGGCCGCGGG - Exonic
910876827 1:91885972-91885994 TGCCGCGGCGCAGCAGCTGCCGG - Exonic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
911073031 1:93847193-93847215 GGCCGGGCTGGAGCGGCCGCCGG + Intergenic
911440572 1:97921046-97921068 CGCGGGGGCGGAGCGGGCGCGGG + Intronic
912246307 1:107965008-107965030 AGCCGCGGCTGACGGGTCGCGGG + Exonic
912800804 1:112718853-112718875 AGCCGAGACGCAGCGGCCCCTGG - Intergenic
913979475 1:143497119-143497141 AGCCGCGGCGGCGGGGGGGCGGG - Intergenic
914293584 1:146297985-146298007 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
914393497 1:147242778-147242800 AGCCGAGGCGGCGCGGGTGCAGG + Exonic
914554628 1:148748768-148748790 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
914869045 1:151458590-151458612 GGCGGCGGCGGAGCGGCCCCTGG - Intronic
919678500 1:200410041-200410063 AGCCGCGGCGCAGTGTCTGCTGG + Exonic
919748646 1:201023553-201023575 AGCCCCGGGGGGCCGGCCGCGGG - Exonic
921190063 1:212700399-212700421 AGCCGCGGCTTCGGGGCCGCTGG - Intergenic
921923240 1:220690818-220690840 AGCGGGGGCGGAGGGGTCGCAGG - Intronic
924763117 1:247007621-247007643 AGACGCGGCGCTGCGGGCGCGGG + Intronic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
1062854349 10:772290-772312 AGCCCCTGGGCAGCGGCCGCCGG - Intergenic
1063848712 10:10161043-10161065 AGCAGCTGCGGAGGGGGCGCTGG + Intergenic
1064086539 10:12349784-12349806 CGGCGCGGAGGAGCGGCCGGGGG - Exonic
1067071875 10:43138450-43138472 AGGCGCGGCGGCGCGCCCGGGGG + Intergenic
1067474467 10:46556749-46556771 GGCCGCGGCGGGGCGGTGGCAGG - Intergenic
1069582144 10:69573388-69573410 AGGCGCGGCGGTGAGACCGCAGG + Intergenic
1072591522 10:96832428-96832450 ACCGGCGGCGGGGCGGCCGGAGG - Intronic
1073043275 10:100621587-100621609 CGGGGCGGCGGGGCGGCCGCCGG + Intergenic
1074586047 10:114768353-114768375 CGCCGCGGCAGAGCGGCTGCTGG - Intergenic
1075031905 10:119029644-119029666 GGCCGCGGCGGCGAGGCCGGGGG + Intergenic
1076880079 10:133235765-133235787 AGCCACGGTGGTGGGGCCGCTGG + Intergenic
1077214574 11:1390098-1390120 TGCCGCGTCGGAGTGGACGCGGG + Intronic
1077343810 11:2037389-2037411 AGCTGGGGCGGAGGGGCCACAGG + Intergenic
1077361833 11:2144322-2144344 AGCCGCGGCCGAGCCGCCACCGG + Intronic
1077486713 11:2842051-2842073 AGCCGCGGCAGAGCTTCCTCTGG + Intronic
1078986797 11:16605538-16605560 AGTTGCGGCGGAGCGGCGGTGGG + Intronic
1079592166 11:22193590-22193612 ACCCGCGGCGCAGAGGCCCCGGG + Intronic
1079867615 11:25756264-25756286 AGCAGCTGCGGAGGGGCCACCGG + Intergenic
1082952334 11:58830857-58830879 AGCCGTGGCAGGGCGGCTGCAGG - Intergenic
1084070072 11:66728171-66728193 AGCCGCGGCCGGGCGGGCGGGGG + Intronic
1084387949 11:68855695-68855717 AGCCCCGGCGGACCCGCCCCCGG + Intergenic
1084666786 11:70580692-70580714 AGCAGCGGGGAAGCGGCCTCAGG - Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1202826796 11_KI270721v1_random:92578-92600 AGCTGGGGCGGAGGGGCCACAGG + Intergenic
1092502607 12:9064353-9064375 AGCGGCGGCGGAGCAGCTGCGGG + Intergenic
1093435495 12:19130251-19130273 GGCCGGGCGGGAGCGGCCGCAGG + Intronic
1095049132 12:37541539-37541561 GGCCGCGGCTGTGCGGCGGCAGG - Intergenic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1096495492 12:52037249-52037271 AGCGGCTGCGGCGCGGCTGCAGG + Intronic
1096843215 12:54391346-54391368 GGCCGAGGCGGAGCGGGGGCGGG + Intergenic
1097218246 12:57430772-57430794 AGCCGCAGCCGAGCGGCCGTGGG - Exonic
1099228153 12:79993438-79993460 AGCAGCTGCGGAGGGGGCGCCGG - Intergenic
1100309133 12:93378138-93378160 GCCCGCGTCGGAGCGGCCGCCGG + Exonic
1102115995 12:110403423-110403445 AGGCGGGAAGGAGCGGCCGCCGG - Intronic
1102278164 12:111598725-111598747 GGCCGCGGGGGAGGGGACGCCGG + Intronic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1105049712 12:133037603-133037625 AGGCGCGCGGGAGTGGCCGCGGG + Exonic
1106956362 13:34942771-34942793 AGCAGCGGCGCTGCCGCCGCCGG - Exonic
1106995067 13:35471324-35471346 GGCCGAGGCCTAGCGGCCGCGGG + Intronic
1109829950 13:67773150-67773172 AGCAGCTGCGGAGGGGGCGCTGG - Intergenic
1110569858 13:76991921-76991943 AGCCGCCGCGGGCCGGGCGCGGG + Exonic
1112091720 13:96090558-96090580 AGCCGCGCCGGGGCGGGAGCAGG + Intergenic
1113517421 13:110914526-110914548 AGTCGCGGCGGGGCAGCCGGGGG - Intronic
1114270675 14:21098324-21098346 GGCGGCGGCGGAGCGGGCGGCGG + Exonic
1117478224 14:56118486-56118508 AGCCACGACGGAGCAGCAGCGGG + Exonic
1119623652 14:76152061-76152083 AGCCGCGGCTGAGCGGCTAAGGG + Intronic
1119743524 14:77028519-77028541 AGCCGCGGCGGCCCGGGCGCCGG - Exonic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1122220964 14:100239015-100239037 AGCAGCGGCCGAGCGAGCGCGGG + Exonic
1122270959 14:100568285-100568307 AGCAGCGGGGCCGCGGCCGCCGG - Intronic
1122866119 14:104604758-104604780 AGCGGCGGCGGGAAGGCCGCGGG + Exonic
1122917361 14:104865296-104865318 GCCCACGGCAGAGCGGCCGCCGG - Exonic
1123092032 14:105746201-105746223 AGCCAAGGCAGAGCAGCCGCAGG - Intergenic
1123162031 14:106287671-106287693 GGCCGGGTCGGAGCGGCCGCTGG - Intergenic
1123180076 14:106461069-106461091 GGCCGGGTCGGAGTGGCCGCCGG - Intergenic
1123808351 15:23897801-23897823 AGGCGAGGCGGACCGGGCGCGGG + Intergenic
1123858327 15:24436299-24436321 AGCCCCAGCGGAGCTGCCACAGG + Intergenic
1123862955 15:24486763-24486785 AGCCCCAGCGGAGCTGCCACAGG + Intergenic
1125508790 15:40282038-40282060 GGCGGCGGCGGCGCGGCCCCAGG + Exonic
1125536248 15:40442196-40442218 GGCGGCGCCGGAGCGGGCGCAGG + Intronic
1125885539 15:43226764-43226786 AGCAGCTGCGGAGCGTGCGCCGG - Intergenic
1126165455 15:45650971-45650993 AGCCGAGGCGGAGCTGCCCCCGG + Intronic
1126800828 15:52295445-52295467 AGGCGCCGCGGAGGGGCCACGGG - Intronic
1126997591 15:54462601-54462623 AGCAGCTGCGGAGGGGGCGCCGG + Intronic
1127415003 15:58749424-58749446 GACCACGGCGGAGCGGCGGCCGG - Intronic
1127417372 15:58771049-58771071 AGCCGCGGGGGCGCGCCCCCCGG + Intergenic
1128866017 15:71115652-71115674 AGGCGAGGCGAGGCGGCCGCCGG + Intronic
1129199875 15:73992335-73992357 ACCCGCGGCGGCGCGGGCGCAGG + Exonic
1130335248 15:82952549-82952571 GGCCCCGTCGGAGCGGCCGCCGG - Exonic
1130460584 15:84156267-84156289 AGCAGCGGGGGAGCGGGGGCTGG - Intergenic
1131056701 15:89379174-89379196 AGCCGCGACGGAGGGTCCGGCGG - Intergenic
1132342351 15:101086510-101086532 AGCCGCGGCCGCGCAGGCGCCGG - Intergenic
1132897943 16:2237729-2237751 AGCCGTGTCTGAGCCGCCGCAGG - Intronic
1132907111 16:2288328-2288350 AGCTGCGGCAGAGGGGACGCAGG + Exonic
1133973071 16:10580728-10580750 AGCCGAGTGGGAGGGGCCGCCGG + Intergenic
1135565854 16:23510418-23510440 AGCCCCGACGCTGCGGCCGCGGG + Exonic
1136087266 16:27894512-27894534 AGGCACGGCGCAGTGGCCGCTGG + Intronic
1136454030 16:30370303-30370325 GCCGGGGGCGGAGCGGCCGCTGG + Intergenic
1137988489 16:53130535-53130557 GGCCGCGGCGGGGCTGCCGGGGG + Intronic
1141727624 16:85799980-85800002 AGCGGCTGCGGACCGGCCTCGGG + Intronic
1141831314 16:86511248-86511270 GGCTGCGGCGGCGCGGCGGCCGG + Exonic
1142049996 16:87951756-87951778 AGCCGCGGCTCAACGGACGCCGG - Intronic
1142188457 16:88706083-88706105 AGCTGCACCGGGGCGGCCGCCGG + Intronic
1142245506 16:88968395-88968417 AGCCCCAGCTGAGGGGCCGCAGG + Intronic
1142371856 16:89686946-89686968 AGCCGGGGCGGGGCGGGCTCAGG + Intronic
1142395348 16:89828566-89828588 AGCTGCGGCGGCGCCGCGGCGGG + Exonic
1142764407 17:2057389-2057411 CGCGGCGCCAGAGCGGCCGCTGG + Exonic
1146912524 17:36657898-36657920 GGCCGCCGCCGAGCAGCCGCGGG - Intergenic
1146926536 17:36749687-36749709 ACACGCGGGGGAGCGGGCGCTGG - Intergenic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1147378158 17:40035246-40035268 AGCCTCTGCAGAGCGGCTGCGGG - Exonic
1147684003 17:42276268-42276290 AGCTGGGCCGGAGCAGCCGCGGG - Exonic
1149685378 17:58531856-58531878 AGCCGCGGCTGCGGTGCCGCGGG + Intronic
1150764626 17:67993546-67993568 CGCGGCGGCGGCGCGGGCGCGGG + Intronic
1151783770 17:76265365-76265387 GGCGGCGGCGGAGCGGGCGGCGG + Exonic
1152049267 17:77959345-77959367 AGCCGAGCCGGGGCGGGCGCTGG + Intergenic
1152225404 17:79090466-79090488 AGCGGCGGCGGAGCAGGCCCGGG - Intronic
1152628461 17:81399204-81399226 CGCCGCGGCGAAGAGGCTGCTGG - Intronic
1152671761 17:81612205-81612227 AGCCCCGGAGGGACGGCCGCCGG - Intronic
1153515140 18:5895364-5895386 AGGGCCGGCGGCGCGGCCGCAGG - Exonic
1154173401 18:12067106-12067128 GGCCCCGGCGGGGCGGCCGGGGG - Intergenic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155519851 18:26656923-26656945 AGCCGCGGCGGAGCGGCCGCGGG + Intronic
1156243035 18:35271860-35271882 AGCAGCTGCGGAGGGGGCGCGGG - Intronic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1160981935 19:1820173-1820195 AGCTGCGGCTGAGAGGCCGGGGG + Intronic
1161384825 19:3985325-3985347 AGCGGCGGCGGGGCCTCCGCGGG - Intronic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162344428 19:10111171-10111193 AGCCGCACCGGAGCAGCGGCTGG + Exonic
1162435389 19:10654828-10654850 AGCCGCGGGGAGGCGGCAGCCGG - Intronic
1162572145 19:11480031-11480053 AGCAGCGGCGGCGGGCCCGCGGG + Intronic
1163635092 19:18433878-18433900 GGCCCCGGCGGGGCGGCCGGGGG + Intronic
1165243144 19:34482559-34482581 AAGCGCGGCCGAGCGGCGGCTGG + Exonic
1166126338 19:40717276-40717298 GGCCCCGGCGGGGCGGCCGGAGG + Exonic
1167019067 19:46861009-46861031 AGCCGCGGCGCGGCGGCAGGAGG + Intergenic
1167129249 19:47573398-47573420 AGCCGGGGAGGAGCGGCGGGGGG + Intergenic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167843401 19:52140063-52140085 AGCCGGGCCGGAGCGGCAGTGGG + Intergenic
1168277083 19:55284345-55284367 GGCCGGGACGGAGCGGTCGCCGG + Exonic
1202693076 1_KI270712v1_random:104988-105010 CGGCGCGGCGGAGAGGCGGCCGG + Intergenic
925929088 2:8693452-8693474 AGCCGCAGCGGGGCGGCGGGAGG + Intergenic
928143709 2:28752340-28752362 GGGCGCGGGGGAGCGGCCTCTGG + Intronic
929075672 2:38077052-38077074 AGCGCGGGAGGAGCGGCCGCAGG - Intronic
929501380 2:42493941-42493963 GACGGCGGCGGGGCGGCCGCCGG - Exonic
929501427 2:42494111-42494133 AGCCGGGGAGGTGCGGGCGCGGG - Intergenic
929604394 2:43225526-43225548 AGCTGCGGCAGCGCGGCGGCCGG - Exonic
930872587 2:56184027-56184049 AGCAGCCTAGGAGCGGCCGCGGG + Intergenic
932887512 2:75560824-75560846 AATCCCGGCGGAGGGGCCGCCGG + Intronic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
934882478 2:97995879-97995901 AGTCGGAGCGGAGAGGCCGCGGG + Exonic
935046792 2:99489994-99490016 AGCCACCGCGGAGCGCGCGCGGG - Exonic
935591862 2:104852460-104852482 CGCAGCCGAGGAGCGGCCGCCGG - Intergenic
937996970 2:127701586-127701608 AGCAGCGGCTCCGCGGCCGCCGG - Exonic
942678231 2:178450841-178450863 AGCCGCGGAGGCGTGGGCGCCGG + Intronic
947729268 2:232419165-232419187 CGGCGCGGCGGAGCGTCCGGGGG - Intergenic
948209117 2:236179287-236179309 AGCCGACGCCGGGCGGCCGCGGG - Intergenic
1169483442 20:6006221-6006243 AGACCCCGCGGCGCGGCCGCAGG + Exonic
1169914693 20:10673616-10673638 AGCCGGGACGCGGCGGCCGCAGG - Exonic
1171034702 20:21705838-21705860 AGCCGCGGCGGCCCAGCCGCGGG - Exonic
1175900334 20:62357494-62357516 AGCAGGGGCGGGGCGGCAGCCGG + Intronic
1176221188 20:63969993-63970015 CCCCGTCGCGGAGCGGCCGCGGG - Intronic
1176377076 21:6092053-6092075 GGGCGGGGCCGAGCGGCCGCGGG + Intergenic
1176448233 21:6840324-6840346 AGCCGGGGCCGAGCGGCCACAGG + Intergenic
1176450628 21:6858565-6858587 GGCGGCGGCGGAGCAGCAGCCGG + Intergenic
1176548359 21:8211520-8211542 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176549776 21:8216132-8216154 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176557667 21:8260361-8260383 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1176567290 21:8394555-8394577 CGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176568701 21:8399166-8399188 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176576615 21:8443401-8443423 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1176826403 21:13705346-13705368 AGCCGGGGCCGAGCGGCCACAGG + Intergenic
1176828798 21:13723583-13723605 GGCGGCGGCGGAGCAGCAGCCGG + Intergenic
1177788300 21:25695663-25695685 AGACGGGGCGGGGCGGCTGCCGG + Intronic
1178400175 21:32278771-32278793 GGCTGCGGAGGAGAGGCCGCTGG - Exonic
1179437176 21:41369845-41369867 AGCCACGGCGGGGCGGGAGCGGG - Intronic
1179746399 21:43446191-43446213 GGGCGGGGCCGAGCGGCCGCGGG - Intergenic
1179810170 21:43865152-43865174 GGCGGCGGCGGCGCGGCCGAGGG + Intergenic
1180559046 22:16601352-16601374 AGCGGCGGCGGCGCGTCCGCGGG + Intergenic
1180837259 22:18936140-18936162 GGCCACGGCAGTGCGGCCGCCGG - Exonic
1182586386 22:31346293-31346315 AGCGGCGGCTGTGCGGCCCCGGG + Intergenic
1184620299 22:45671812-45671834 CGCCGCGGGGGAGGGGGCGCCGG - Exonic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203254665 22_KI270733v1_random:132458-132480 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203262721 22_KI270733v1_random:177537-177559 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1203287352 22_KI270734v1_random:161439-161461 GGCCACGGCAGTGCGGCCGCCGG - Intergenic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
951543631 3:23806118-23806140 AGGCCCGGCGGCGCGGCCGGGGG - Intronic
951907837 3:27721698-27721720 AGCCGCGGGGAAGCCGCCGGGGG + Exonic
953096279 3:39779892-39779914 AGCAGCTGCGGAGGGGGCGCCGG + Intergenic
954618627 3:51983380-51983402 ATCCGCGCCGACGCGGCCGCTGG + Exonic
955818775 3:62874800-62874822 AGCAGCGGCGGCGGGGCCGGGGG - Exonic
955916248 3:63911828-63911850 AGCCGCCGCAGAGCGGACTCCGG - Intronic
956678188 3:71754298-71754320 GGCCGCGGCGGGGGCGCCGCCGG + Exonic
958425455 3:93973883-93973905 AGCCTCGGCGGAACAGCCGGGGG + Exonic
961545312 3:127629176-127629198 AGCCGCAGCGGCGCGGCGCCCGG - Exonic
964786289 3:160399898-160399920 GGCCGCCGGGGAGCGGCCGAGGG - Intronic
966743392 3:183254068-183254090 AGGCGCGGCGGGGCGGGGGCGGG - Intronic
968178188 3:196569036-196569058 AGCGGCGGCGGCGCGGGCGCGGG + Exonic
968232956 3:197015161-197015183 AGGCGGGGAGGAGCGACCGCAGG - Intronic
968502301 4:956353-956375 GGCCGCGGAGGAGCAGACGCTGG - Intronic
975870834 4:78776583-78776605 AGCGGCGGCGGAGCGGCGGGTGG + Exonic
976629372 4:87220698-87220720 AGCCGCGGGGGCGAGGCCGTGGG - Intronic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
981617359 4:146655457-146655479 GGCCGCGGCGGAGCGGCCGGCGG - Intergenic
981920475 4:150079474-150079496 AGGTGCGGCGGAGCGCCGGCAGG + Intronic
982745668 4:159102906-159102928 AGACGCGAGGGCGCGGCCGCTGG + Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
983792238 4:171813049-171813071 AGCCGGGGCGCGGCGGCTGCGGG - Intronic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985577458 5:680142-680164 AGCAGGGGCGCAGGGGCCGCGGG - Intronic
985592390 5:772238-772260 AGCAGGGGCGCAGGGGCCGCGGG - Intergenic
986152484 5:5140275-5140297 AGCCGCGGCGGCGGGGGCGGCGG - Intergenic
986190790 5:5494714-5494736 AGCTGCGGGGGCGGGGCCGCTGG - Intergenic
988578003 5:32444839-32444861 GGCCTCGGCGGTGCGGGCGCGGG + Intergenic
988796448 5:34656800-34656822 GGCCGCGGCGGAGGGAGCGCGGG + Intronic
989582157 5:43043101-43043123 AGGCGCGGCGGAGAAACCGCAGG + Exonic
990510857 5:56487922-56487944 AGCAGCTGCGGAGGGGGCGCTGG + Intergenic
992098346 5:73382207-73382229 AGCCGCGCTGGCGGGGCCGCGGG + Intergenic
992431598 5:76715994-76716016 AGCGGCGGCTGAGGGACCGCGGG + Intergenic
992716304 5:79514221-79514243 GGCCGCCGCGGAGCCGCGGCCGG + Intergenic
995224606 5:109689415-109689437 AGCGGCGGCGCAGCAGCCGCTGG - Exonic
996298571 5:121954209-121954231 AGCGGCGCCGGCGCGGGCGCGGG + Intergenic
996900483 5:128537830-128537852 AGGCGCGGCGGAGGTGCAGCCGG + Exonic
997990806 5:138543135-138543157 CGCCGCCGCGGAGCCGCCGCCGG - Exonic
999271998 5:150302237-150302259 GGCTGGGGCGGAGCGGCCGAGGG + Exonic
1002029341 5:176416455-176416477 AGCCGCGGGGGAGCCGGCGTCGG + Exonic
1002887828 6:1312045-1312067 CGCCCCCGCGGAGCCGCCGCAGG + Intergenic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1003871975 6:10411167-10411189 ACCCTCGGCGGTTCGGCCGCAGG + Intronic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1004396342 6:15248821-15248843 AGGCGCGGCGGGGCGGCGGGGGG + Intronic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1007785344 6:44276482-44276504 AGCCGTGGCGGTGCAGCGGCCGG - Exonic
1008649072 6:53544968-53544990 CGCCGCGGCAGCGCGGCCGTGGG - Exonic
1011044371 6:83065808-83065830 CGCCGCAGCGGGGCTGCCGCTGG - Exonic
1013793061 6:113857784-113857806 AGCCGCCGCGGAGAGGCCTGGGG + Exonic
1015749984 6:136550088-136550110 AGTCGCGGTGGAGCGCCCGAGGG + Intronic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017877534 6:158536880-158536902 GGCAGCGGCGGGGCGGCCGGAGG + Intronic
1018531209 6:164765311-164765333 CACCGCTGCGGAGCGGCAGCAGG + Intergenic
1018840197 6:167510876-167510898 AGCGGCGGCAGTGCGGCCACGGG + Intergenic
1019563940 7:1670550-1670572 GGCGGCGGCGGAGCGGGCGCAGG + Intergenic
1026098338 7:67364736-67364758 AGCAGCTGCGGAGGGGGCGCAGG - Intergenic
1026765105 7:73155202-73155224 AGCCGCCGCGGACGGGGCGCGGG + Intergenic
1027041578 7:74964957-74964979 AGCCGCCGCGGACGGGGCGCGGG + Exonic
1027082064 7:75237412-75237434 AGCCGCCGCGGACGGGGCGCGGG - Intergenic
1029461093 7:100694187-100694209 AGCAGCGGGGGAGGGGGCGCTGG + Intergenic
1031629847 7:124033026-124033048 AGCGGCGGCGGTGCAGCCTCGGG - Intergenic
1032130714 7:129225238-129225260 TCCCGCCGCGGAGCGGCCCCCGG + Exonic
1034618273 7:152436655-152436677 AGCGGCGGCGGCGCGTCCGCGGG - Intergenic
1036952513 8:13154410-13154432 AGCAGCTGCGGAGGGGGCGCCGG - Intronic
1037336837 8:17800883-17800905 AGCGCCGGCGGAGCGGAGGCGGG - Intronic
1040471253 8:47737614-47737636 AGCCGCCGCGCAGCAGCCCCAGG - Exonic
1045571342 8:103371672-103371694 AGCCGCTGCGGGGAGGCGGCGGG - Exonic
1045583260 8:103500929-103500951 AGAGGCGGCTGAGAGGCCGCCGG - Intronic
1048553968 8:135457600-135457622 GGCCGAGGAGGAGCGGGCGCGGG - Exonic
1049854472 8:144852838-144852860 TTCCGCGGAGGAGCGCCCGCCGG - Intronic
1051929053 9:22363685-22363707 AGCAGCTGCGGAGGGGGCGCTGG - Intergenic
1056852453 9:90095930-90095952 AGCAGCGACAGAGCGGCAGCCGG - Intergenic
1057152724 9:92809015-92809037 AGCCACGGTGCAGCCGCCGCCGG - Intergenic
1057478659 9:95426846-95426868 CGCCGCGGGGGAGAGGCCTCCGG - Intergenic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1060105201 9:120868987-120869009 AGCCGCGGGGGTGGGGCCTCGGG - Intronic
1060389869 9:123268467-123268489 GGCGGCGGCGGAGCGGGAGCGGG - Intronic
1060480421 9:124013896-124013918 CCCGGCGGCGGAGGGGCCGCTGG + Intronic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061961740 9:133992249-133992271 AGTGGCGGCAGTGCGGCCGCTGG - Exonic
1061967694 9:134025449-134025471 AGACACGGCCCAGCGGCCGCCGG + Intergenic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062430819 9:136526194-136526216 CCCCGAGGTGGAGCGGCCGCTGG + Intronic
1062476013 9:136727950-136727972 GGCCGCGGAGGAGGCGCCGCTGG - Intergenic
1062718640 9:138023488-138023510 AGCCGCGCCGGTGGTGCCGCCGG - Exonic
1203518554 Un_GL000213v1:25952-25974 GGCGGCGGCGGAGCAGCAGCCGG - Intergenic
1203520958 Un_GL000213v1:44194-44216 AGCCGGGGCCGAGCGGCCACAGG - Intergenic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203471066 Un_GL000220v1:115603-115625 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203478887 Un_GL000220v1:159575-159597 CGTCGCGGCGTAGCGTCCGCGGG - Intergenic
1185736624 X:2500833-2500855 AGCTGCTGCGGCGCTGCCGCGGG - Exonic
1190440464 X:50470542-50470564 AGCAGCGGCGGAGCCGGCGGCGG + Exonic
1191675122 X:63785239-63785261 AGGGGCGGCGGAGGGGGCGCTGG - Intronic
1197745871 X:129932077-129932099 GGCCGCGAAGGAGAGGCCGCTGG - Intergenic
1199600595 X:149539414-149539436 AGCTGGGGCGGAGCTGCCGGAGG - Intergenic
1200216543 X:154370593-154370615 AGCCGCGGAGGCGCGGCCTGCGG + Intronic
1200216561 X:154370645-154370667 AGCCGGGGCGCAGCGGGCGGGGG + Intronic
1200550308 Y:4570994-4571016 AGCAGCTGCGGAGGGGGCGCTGG + Intergenic
1202119971 Y:21511240-21511262 TGCTGGGGCGGAGCGGCCTCAGG + Intergenic
1202122422 Y:21534781-21534803 TGCTGGGGCGGAGCGGCCTCAGG + Intronic
1202156583 Y:21894602-21894624 TGCTGGGGCGGAGCGGCCTCAGG - Intronic
1202159031 Y:21918143-21918165 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202185480 Y:22183058-22183080 TGCTGGGGCGGAGCGGCCTCAGG - Intergenic
1202205880 Y:22403338-22403360 TGCTGGGGCGGAGCGGCCTCAGG + Intronic