ID: 1155521077

View in Genome Browser
Species Human (GRCh38)
Location 18:26669719-26669741
Sequence ATGCTGGTCTAGGTTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155521072_1155521077 -5 Left 1155521072 18:26669701-26669723 CCTCATCACACACTAGAAATGCT No data
Right 1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG No data
1155521071_1155521077 21 Left 1155521071 18:26669675-26669697 CCTAAGGACATTCTGATGCAAGT No data
Right 1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG No data
1155521070_1155521077 27 Left 1155521070 18:26669669-26669691 CCATCACCTAAGGACATTCTGAT No data
Right 1155521077 18:26669719-26669741 ATGCTGGTCTAGGTTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155521077 Original CRISPR ATGCTGGTCTAGGTTGGGCA TGG Intergenic
No off target data available for this crispr