ID: 1155521366

View in Genome Browser
Species Human (GRCh38)
Location 18:26672206-26672228
Sequence ACTGTTCAACAGAAAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155521366_1155521371 23 Left 1155521366 18:26672206-26672228 CCACACACTTTCTGTTGAACAGT No data
Right 1155521371 18:26672252-26672274 GGCTTTGGTTTTGTGCTCAGAGG No data
1155521366_1155521368 8 Left 1155521366 18:26672206-26672228 CCACACACTTTCTGTTGAACAGT No data
Right 1155521368 18:26672237-26672259 TACCTCCTCTTTTCAGGCTTTGG No data
1155521366_1155521367 2 Left 1155521366 18:26672206-26672228 CCACACACTTTCTGTTGAACAGT No data
Right 1155521367 18:26672231-26672253 TTAATTTACCTCCTCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155521366 Original CRISPR ACTGTTCAACAGAAAGTGTG TGG (reversed) Intergenic
No off target data available for this crispr