ID: 1155522576

View in Genome Browser
Species Human (GRCh38)
Location 18:26684015-26684037
Sequence CACATACACCTTCCTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155522571_1155522576 12 Left 1155522571 18:26683980-26684002 CCTCCATTGCCTTAATAAAGACT No data
Right 1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG No data
1155522574_1155522576 3 Left 1155522574 18:26683989-26684011 CCTTAATAAAGACTGAGGTGCAT No data
Right 1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG No data
1155522572_1155522576 9 Left 1155522572 18:26683983-26684005 CCATTGCCTTAATAAAGACTGAG No data
Right 1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG No data
1155522570_1155522576 25 Left 1155522570 18:26683967-26683989 CCTGGCTGTTTTTCCTCCATTGC No data
Right 1155522576 18:26684015-26684037 CACATACACCTTCCTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155522576 Original CRISPR CACATACACCTTCCTGCAAA TGG Intergenic
No off target data available for this crispr