ID: 1155522679

View in Genome Browser
Species Human (GRCh38)
Location 18:26685057-26685079
Sequence ATTCACCAGCTTCCATGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155522679_1155522686 29 Left 1155522679 18:26685057-26685079 CCATTCCATGGAAGCTGGTGAAT No data
Right 1155522686 18:26685109-26685131 TGGAGTTTGTCATTAAAGTGTGG No data
1155522679_1155522685 9 Left 1155522679 18:26685057-26685079 CCATTCCATGGAAGCTGGTGAAT No data
Right 1155522685 18:26685089-26685111 CCTTATAAGGTCTAGCTTTCTGG No data
1155522679_1155522683 -4 Left 1155522679 18:26685057-26685079 CCATTCCATGGAAGCTGGTGAAT No data
Right 1155522683 18:26685076-26685098 GAATATGTAGGGTCCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155522679 Original CRISPR ATTCACCAGCTTCCATGGAA TGG (reversed) Intergenic
No off target data available for this crispr