ID: 1155523941

View in Genome Browser
Species Human (GRCh38)
Location 18:26697561-26697583
Sequence GGGTGGGTCAATGCAATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155523933_1155523941 4 Left 1155523933 18:26697534-26697556 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG No data
1155523934_1155523941 3 Left 1155523934 18:26697535-26697557 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155523941 Original CRISPR GGGTGGGTCAATGCAATTTG AGG Intergenic
No off target data available for this crispr