ID: 1155526527

View in Genome Browser
Species Human (GRCh38)
Location 18:26721514-26721536
Sequence CAGGGAAAGCCTAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155526527_1155526539 6 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526539 18:26721543-26721565 AGGGTCCTTTCTTTGTGCTGGGG No data
1155526527_1155526540 7 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526540 18:26721544-26721566 GGGTCCTTTCTTTGTGCTGGGGG No data
1155526527_1155526537 4 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526537 18:26721541-26721563 CCAGGGTCCTTTCTTTGTGCTGG No data
1155526527_1155526538 5 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526538 18:26721542-26721564 CAGGGTCCTTTCTTTGTGCTGGG No data
1155526527_1155526541 10 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526541 18:26721547-26721569 TCCTTTCTTTGTGCTGGGGGAGG No data
1155526527_1155526543 28 Left 1155526527 18:26721514-26721536 CCTGCATCCCTAGGCTTTCCCTG No data
Right 1155526543 18:26721565-26721587 GGAGGTGAGTTGTCAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155526527 Original CRISPR CAGGGAAAGCCTAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr