ID: 1155529951

View in Genome Browser
Species Human (GRCh38)
Location 18:26756839-26756861
Sequence GTCTGGCGCCTGTGCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155529941_1155529951 17 Left 1155529941 18:26756799-26756821 CCGACACCTGCCAAGTATTGCCT No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data
1155529944_1155529951 11 Left 1155529944 18:26756805-26756827 CCTGCCAAGTATTGCCTGGGCTG No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data
1155529946_1155529951 -3 Left 1155529946 18:26756819-26756841 CCTGGGCTGTCAGTAGCTGTGTC No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data
1155529940_1155529951 23 Left 1155529940 18:26756793-26756815 CCATCTCCGACACCTGCCAAGTA No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data
1155529939_1155529951 26 Left 1155529939 18:26756790-26756812 CCTCCATCTCCGACACCTGCCAA No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data
1155529945_1155529951 7 Left 1155529945 18:26756809-26756831 CCAAGTATTGCCTGGGCTGTCAG No data
Right 1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155529951 Original CRISPR GTCTGGCGCCTGTGCAGGGT GGG Intergenic
No off target data available for this crispr