ID: 1155531977

View in Genome Browser
Species Human (GRCh38)
Location 18:26776601-26776623
Sequence CCAACCAGTAAGTTCAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155531972_1155531977 -8 Left 1155531972 18:26776586-26776608 CCTGCCCAAGGTTACCCAACCAG No data
Right 1155531977 18:26776601-26776623 CCAACCAGTAAGTTCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155531977 Original CRISPR CCAACCAGTAAGTTCAAAAG AGG Intergenic
No off target data available for this crispr