ID: 1155532607

View in Genome Browser
Species Human (GRCh38)
Location 18:26782358-26782380
Sequence TTCCAAGGTTGAGGGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155532601_1155532607 30 Left 1155532601 18:26782305-26782327 CCTAGAGGAAACTGACCTAGGAC No data
Right 1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG No data
1155532602_1155532607 15 Left 1155532602 18:26782320-26782342 CCTAGGACAATGACATGAGTAGT No data
Right 1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155532607 Original CRISPR TTCCAAGGTTGAGGGAGTTC AGG Intergenic
No off target data available for this crispr