ID: 1155533974

View in Genome Browser
Species Human (GRCh38)
Location 18:26796406-26796428
Sequence TTCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852450
Summary {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155533974_1155533982 6 Left 1155533974 18:26796406-26796428 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1155533982 18:26796435-26796457 GGTGGATGGATGACGAGCTCAGG No data
1155533974_1155533980 -8 Left 1155533974 18:26796406-26796428 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1155533980 18:26796421-26796443 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155533974 Original CRISPR TTCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr