ID: 1155533974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:26796406-26796428 |
| Sequence | TTCCAAAGTGCTGGGATTAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 852450 | |||
| Summary | {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155533974_1155533982 | 6 | Left | 1155533974 | 18:26796406-26796428 | CCTGTAATCCCAGCACTTTGGAA | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||
| Right | 1155533982 | 18:26796435-26796457 | GGTGGATGGATGACGAGCTCAGG | No data | ||||
| 1155533974_1155533980 | -8 | Left | 1155533974 | 18:26796406-26796428 | CCTGTAATCCCAGCACTTTGGAA | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||
| Right | 1155533980 | 18:26796421-26796443 | CTTTGGAAGGCCAAGGTGGATGG | 0: 52 1: 2206 2: 28156 3: 83347 4: 161118 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155533974 | Original CRISPR | TTCCAAAGTGCTGGGATTAC AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||