ID: 1155535601

View in Genome Browser
Species Human (GRCh38)
Location 18:26813274-26813296
Sequence AAAGGCAACAGGACTCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155535601_1155535607 25 Left 1155535601 18:26813274-26813296 CCTACATGAGTCCTGTTGCCTTT No data
Right 1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG No data
1155535601_1155535604 -7 Left 1155535601 18:26813274-26813296 CCTACATGAGTCCTGTTGCCTTT No data
Right 1155535604 18:26813290-26813312 TGCCTTTATTGTGGATACAATGG No data
1155535601_1155535606 22 Left 1155535601 18:26813274-26813296 CCTACATGAGTCCTGTTGCCTTT No data
Right 1155535606 18:26813319-26813341 TTATGTGATTCACTTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155535601 Original CRISPR AAAGGCAACAGGACTCATGT AGG (reversed) Intergenic
No off target data available for this crispr