ID: 1155535605

View in Genome Browser
Species Human (GRCh38)
Location 18:26813292-26813314
Sequence CTCCATTGTATCCACAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155535605_1155535606 4 Left 1155535605 18:26813292-26813314 CCTTTATTGTGGATACAATGGAG No data
Right 1155535606 18:26813319-26813341 TTATGTGATTCACTTACAAAAGG No data
1155535605_1155535608 13 Left 1155535605 18:26813292-26813314 CCTTTATTGTGGATACAATGGAG No data
Right 1155535608 18:26813328-26813350 TCACTTACAAAAGGTGGAAGTGG No data
1155535605_1155535607 7 Left 1155535605 18:26813292-26813314 CCTTTATTGTGGATACAATGGAG No data
Right 1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155535605 Original CRISPR CTCCATTGTATCCACAATAA AGG (reversed) Intergenic
No off target data available for this crispr