ID: 1155535607

View in Genome Browser
Species Human (GRCh38)
Location 18:26813322-26813344
Sequence TGTGATTCACTTACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155535601_1155535607 25 Left 1155535601 18:26813274-26813296 CCTACATGAGTCCTGTTGCCTTT No data
Right 1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG No data
1155535603_1155535607 14 Left 1155535603 18:26813285-26813307 CCTGTTGCCTTTATTGTGGATAC No data
Right 1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG No data
1155535605_1155535607 7 Left 1155535605 18:26813292-26813314 CCTTTATTGTGGATACAATGGAG No data
Right 1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155535607 Original CRISPR TGTGATTCACTTACAAAAGG TGG Intergenic
No off target data available for this crispr